Entry information : EguPrx51
Entry ID 11511
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-01-22 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-17 (Christophe Dunand)
Peroxidase information: EguPrx51
Name EguPrx51
Class Class III peroxidase    [Orthogroup: Prx059]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx51
start..stop
S start..stop
EgrPrx53 686 0 1..334 1..334
EglPrx53 686 0 1..334 1..334
EgrPrx54 677 0 1..334 1..334
EcamPrx53 674 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6270..6497 228 N° 2 6630..6821 192 N° 3 6948..7113 166 N° 4 8570..8985 416
join(6270..6497,6630..6821,6948..7113,8570..8985)


exon

Literature and cross-references EguPrx51
Protein sequence: EguPrx51
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   36048.09 (33055.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.38 (5.93) Peptide Signal:   %s   cut: 30 range:30-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSTLSSPTVVALFAAALLFLLHPLNAELTADFYAKTCPDVSSIVQTVIHEALQYDPRITASLLRLHFHDCFVQGCDGSVLLDNSPTIKSEKDAAPNFNSARGFGVVDKIKAAIESTCPETVSCADILALAANASVYLSGGPYWTVLLGRRDSLTANQGLANTSIPSPFESYANLTSKFYVLGLDITDLVTLSGAHTFGRAHCKSFTPRLYNFTKNGGPDPTLSPWYLTALQKLCPPNFNPKVITDLDPTTPNLFDNHYYSNLQKNDGLFETDQELYSTAGAATVPIVNSFSADQSAFFKSFTRSIVNMGNISPLTGSNGEIRCNCRKVNK

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Scaffold_1_2256 (6270..8985).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GTGAGTCCCTAC
ACTAGATCAATTCCCATTGACAATGAGTTCCAACTTGCCGCATTCTTTTTACAGTACTTTCGATCAGATTATCGAGTCATTAGTCACGTAACCTAATGCTTGAGCATGACGTGTTTAAAG

GGGTGTGATGGATCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATT
GAGAGCACTTGTCCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
GTATATGTCGTTTTAGTCAAAGAAACATAAAACATATTTAAAGTATAC
TTAGGATTCATTATTGTCACTTGGCCTACACGAATTATAATTGTGTTTCTCTTGATTATCACATTTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGAC
AGCTTGACGGCGAACCAAGGACTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTT
TCCG
GTAAAATAGAACAGTTGGACTTGCATTTTGATACGAACATGCAACTACAGATATTGATGCACAAAATAGATTAACAGAGTGAAATGTCGGATTTTTTTCACATAAGTTATCGGCAC
AAACATCGCATCACTTTCATTTAGCACATTTCAACTTCCTAATATGATCAAGGTCTCTTCTTCATTGAGATCAACTGACAGGCATGGGCTGTGCATGTGCATGGGCCGTGCCCCGGCAAT
GCTATCTACTAGAAGGAATTTTAGTCAAGGATTAAGGGTTAAATTTNTTTTATATCTAAAATTGAATTTAAGTAAAGAATCGTCCTAAAACATGTGATCGACTAAAGTGCATGTGTTGTG
CCTAGGCTGTACCTGGGTCGTGCATGGGCTATGCACATTTACTAGAAGGAATTTTGACTAAGGATTAATGATTTCTTTTTTACCAAAAATTGAAAAAGTAAAGGATTGCCCTTCACTTGA
GATCAACTGACGTGCATGCGTTGTGCCTGGGCCATGCCATGTTGTGCATGGGTATATAGATATATTAGAAGGAATTTTAGCTAAAGGATTAAGGGTTTCTTTTCAATCTAAAATTGAATA
AGTAAAGGATTGCCCCGACTTAATTTCAGGAGTAGTTGTGTATCATCACTACTCTAAACAAGATAGATTATTTAAAAACAATTTTTTGCATGACCGAGACTTATCTCCTCGGTAAATTCA
AAAAGGAGAGGAAGCCGATGATATGCAATTTCATTAAATTAGAAATTATGGGTTCATACATTTGCAGGTCCATAATTTGCTAGTCCTTGATAAAAATGGTAATTCAATAGGGTTAGTTTG
ATTGAACTGAATGAGTATAGTTAAAATCTCCTTGTGTGGATCCCACTTATCTTTAATTCAAATGGATCTAAATCAAGCCCGTATCAGCAACTCTTTAAGTCTTATCTAGTATAACTTCTG
CTATCAAGACGAAGAAGTGGTCAATGATGACACTTCATCGTTCAATTCATGACAAGGTTCATAGCGCTGAAACCATCGAATTAATGTAATTTTTTTTTTGTTGTGGTTTGTTTTCAATTA
AACTAGTGTACTTTTATGTGTAATTTTTTTATTACAAATTTGAAAAATATATTCGTGTTCAATGGGTAATTTTATATTTCTGATATCATTACAAGAGTATAAATATCAGGGGAGAATGCT
ATCAAAATTTGCAAGCTCCTCACATACTTGTTTGAGAAATGCCAAGTATACTGAGGTCATTTGATAGAATCAATAAAATAAGTGATGTCACATATCATTATTATTTATTTATATTTTTAC
TAACGAGTTTGTTGCATATGTTTAGTATACAAATTCTATTAAGCATTCCTAGTATTGGTCTATTTATCCACCTTCACAATTGAGCTCTGCAGATATTTTGTTCTCTTAGCTAATTATTCG
TGCATATGATAATAAAACAGGAGCTCACACCTTTGGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACAAAAAATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTA
CTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACTTCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGA
CGGGCTTTTTGAGACTGATCAAGAGCTGTACTCGACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGT
AAACATGGGAAACATCAGTCCTCTCACCGGAAGTAACGGGGAGATCAGGTGCAATTGCAGGAAGGTCAATAAGAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GGGTGTGATGGA
TCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGT
CCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACAGCTTGACGGCGAACCAA
GGACTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTTTCCG
GAGCTCACACCTTT
GGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACAAAAAATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAAC
TTCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTGAGACTGATCAAGAGCTGTACTCG
ACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATCAGTCCTCTCACCGGAAGT
AACGGGGAGATCAGGTGCAATTGCAGGAAGGTCAATAAGAGT

Retrieve as FASTA