Entry information : EguPrx55
Entry ID 11515
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2016-01-18 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-19 (Christophe Dunand)
Peroxidase information: EguPrx55
Name EguPrx55
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx55
start..stop
S start..stop
EgrPrx55 660 0 1..333 1..333
EglPrx55 658 0 1..333 1..333
EcamPrx55 650 0 1..333 1..332
MePrx53 522 0 3..333 5..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9227..9451 225 N° 2 9590..9775 186 N° 3 9904..10075 172 N° 4 10430..10845 416
join(9227..9451,9590..9775,9904..10075,10430..10845)


exon

Literature and cross-references EguPrx55
Protein sequence: EguPrx55
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (305)
PWM (Da):   %s   34818.02 (31913.5)  
PI (pH):   %s   4.9 (4.46) Peptide Signal:   %s   cut: 29 range:29-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVRSHAPSSLMGIAVFAALLFLLHPSSAQLSSNFYATSCPNVSNIVQTVIQQALQSDPRITASLLRLHFHDCFVDGCDGSLLLDNSATITSEKDAAPNTNSTRGFDVVDNIKSAIESSCPGTVSCADILALGAQASVLQSGGPSWTVLLGRRDSLTANQAGANTSIPSPFGSLANLTSQFAAVGLDTNDLVTLSGAHTFGRAQCRTFSPRLYNFNASGSPDPTISPSYLTTLQQLCPQNGSGSVLANLDPTTVDTFDNNYYANLQNNQGLLQSDQELFSTSGAATISIVNSFSGNQSAFFQSFAQSMINMGNISPLTGSSGEIRSNCRKVNG

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
scaffold_1_2259 (9227..10845)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCGTTCTCACGCTCCTTCCTCGCTGATGGGGATAGCGGTTTTCGCCGCGTTGTTGTTTCTCCTCCATCCGTCGAGTGCTCAATTAAGCTCAAACTTTTATGCCACATCATGCCCG
AATGTGTCCAACATCGTCCAAACCGTGATCCAGCAGGCCCTTCAATCCGACCCGCGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTTGTTGAC
GTGAGTCCCTAAGCT
TGGTCTTGGTCAACTCCCGTTAACAGCGTGTCCTAAATTAAGCGTTTTTCGTTTTGACTTTCAATCCGATTATCGGGTAGTTGGTCACTTGAACTAACTTTTGAGCATACTATGTGTTGA
CAGGGGTGTGATGGATCGTTGTTGCTGGACAACAGCGCAACCATTACGAGTGAGAAAGACGCAGCTCCGAATACAAATTCGACAAGAGGGTTCGATGTGGTGGACAACATCAAATCAGCC
ATCGAGAGCTCTTGTCCTGGGACCGTGTCTTGCGCCGACATTCTCGCCCTCGGTGCTCAAGCTTCTGTC
GTTCTGGTAGACATAGCTATAGTCAAAGAAACTTTAAATATAAATTCAAAG
CATATCTAGGGTTGGCTACTGATACTTGGCTTCCACGAATCATAATGGTGCTTCTCTTGATTGTCACTCTTATAAAATTGCAGTCAGGAGGTCCATCTTGGACGGTGCTCTTGGGGAGGA
GGGACAGCTTGACGGCGAACCAAGCAGGAGCGAACACATCGATACCTAGCCCTTTTGGTTCCTTGGCTAACCTCACTTCCCAATTCGCCGCTGTTGGCTTGGACACCAATGACCTTGTCA
CTCTTTCCG
GTAAAGAACCACAGACAAAAAGAAGAGCTAAAGTGTATTGTTGGACTTGCATATGAAGATCCAAAGGATGGTGTCAAAATTTGCATACAAACTCATAGATTTATATGCTAA
ATGATAAGTTTATTAAGGTCGTTTTAAATTAATATATCAAGTAACATCGTAGATCGCAATTATTTTACATTTAACATGACCCACTTACTCAGATGCATCCTAATGAATTTGTCACATTTA
TTTGGTATACAACTTATTTTAAGCATACCTAGGATTGCTCTATTCATCGACTTCCATAACTAAGCATTTGCAGATTCTTTGTTCAGCCTCAGCTAACTTTTCGTGCATCTGATCATGAAA
CAGGAGCTCACACCTTTGGACGTGCACAATGCAGGACATTCAGCCCTAGGCTCTACAACTTCAACGCGAGTGGCAGCCCAGATCCAACCATAAGTCCTTCATACTTGACCACTCTCCAAC
AACTTTGCCCACAGAATGGAAGCGGCTCCGTCCTCGCCAACCTCGACCCGACGACCGTGGACACATTCGACAACAACTACTACGCCAACCTCCAGAACAACCAAGGGCTTCTTCAGTCCG
ATCAAGAGCTGTTCTCAACATCTGGCGCCGCAACGATCTCCATCGTCAACAGCTTCAGCGGCAACCAGAGCGCCTTCTTCCAGAGCTTTGCTCAATCGATGATAAACATGGGAAACATTA
GTCCTCTCACCGGAAGTAGTGGGGAGATCAGATCGAATTGCAGGAAGGTCAACGGGAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCGTTCTCACGCTCCTTCCTCGCTGATGGGGATAGCGGTTTTCGCCGCGTTGTTGTTTCTCCTCCATCCGTCGAGTGCTCAATTAAGCTCAAACTTTTATGCCACATCATGCCCG
AATGTGTCCAACATCGTCCAAACCGTGATCCAGCAGGCCCTTCAATCCGACCCGCGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTTGTTGAC
GGGTGTGATGGATCG
TTGTTGCTGGACAACAGCGCAACCATTACGAGTGAGAAAGACGCAGCTCCGAATACAAATTCGACAAGAGGGTTCGATGTGGTGGACAACATCAAATCAGCCATCGAGAGCTCTTGTCCT
GGGACCGTGTCTTGCGCCGACATTCTCGCCCTCGGTGCTCAAGCTTCTGTC
TTGCAGTCAGGAGGTCCATCTTGGACGGTGCTCTTGGGGAGGAGGGACAGCTTGACGGCGAACCAAGCA
GGAGCGAACACATCGATACCTAGCCCTTTTGGTTCCTTGGCTAACCTCACTTCCCAATTCGCCGCTGTTGGCTTGGACACCAATGACCTTGTCACTCTTTCCG
GAGCTCACACCTTTGGA
CGTGCACAATGCAGGACATTCAGCCCTAGGCTCTACAACTTCAACGCGAGTGGCAGCCCAGATCCAACCATAAGTCCTTCATACTTGACCACTCTCCAACAACTTTGCCCACAGAATGGA
AGCGGCTCCGTCCTCGCCAACCTCGACCCGACGACCGTGGACACATTCGACAACAACTACTACGCCAACCTCCAGAACAACCAAGGGCTTCTTCAGTCCGATCAAGAGCTGTTCTCAACA
TCTGGCGCCGCAACGATCTCCATCGTCAACAGCTTCAGCGGCAACCAGAGCGCCTTCTTCCAGAGCTTTGCTCAATCGATGATAAACATGGGAAACATTAGTCCTCTCACCGGAAGTAGT
GGGGAGATCAGATCGAATTGCAGGAAGGTCAACGGGAGT

Retrieve as FASTA