Entry information : ZmPrx105 (GRMZM2G127945)
Entry ID 1152
Creation 2006-06-05 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Christophe Dunand)
Peroxidase information: ZmPrx105 (GRMZM2G127945)
Name (synonym) ZmPrx105 (GRMZM2G127945)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Endosperm
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx105
start..stop
S start..stop
ZmPrx142 622 0 1..325 1..326
SbPrx10 597 0 1..325 1..327
PviPrx02 597 0 1..325 1..324
SiPrx162 577 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 96240018..96240242 225 N° 2 96240403..96240582 180 N° 3 96240776..96240938 163 N° 4 96241698..96242107 410
join(96240018..96240242,96240403..96240582,96240776..96240938,96241698..96242107 )


exon

Literature and cross-references ZmPrx105 (GRMZM2G127945)
Literature Lai,J., Dey,N., Kim,C.S., Bharti,A.K., Rudd,S., Mayer,K.F., Larkins ,B., Becraft,P. and Messing,J. Characterization of the maize endosperm transcriptome and its comparison to the rice genome. Genome Res. 14 (10), 1932-1937 (2004).
DNA ref. GenBank:   AC208680 (75316..77402)
Protein sequence: ZmPrx105 (GRMZM2G127945)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (299)
PWM (Da):   %s   34672.19 (32138.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.07 (5.82) Peptide Signal:   %s   cut: 27 range:27-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQPACSAALLAAFLVVLACSAVSCRGQLADNFYAGKCGNFSVEAIIHDAVKARLAWDKRMVAGLLHLQFHDCFVAGCDASILLDGPNTEKTAVENSGIFGYDFIDDVKTALERACPGVVSCADIIIAATRDAVGMCGGPSYQVQLGRRDGMVSQASMASILPGPGVDIPTAINLFARKGLNSFEMVSLMGAHTVGVTHCSVIHDRLFNFNGTGLPDPAMDPVYVWILSTFACPKGQAFDNIVYLDDPSSILLVDKSYYSQIMKRHGVLSVDQALGDHSATAWMVRFLATTDFFPSMFSYALNKLAALDVLTGTAGEIRSNCRRTN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCCGGCCTGCTCCGCCGCGCTGCTCGCCGCCTTCCTCGTCGTGCTGGCTTGTTCAGCCGTGAGCTGCCGCGGTCAGCTGGCCGACAACTTCTACGCCGGCAAGTGCGGCAACTTC
AGCGTGGAGGCCATCATCCACGACGCCGTCAAGGCGCGGCTCGCGTGGGACAAGAGGATGGTCGCCGGCCTCCTCCACCTGCAGTTCCACGACTGCTTCGTCGCT
GTACGTACATGCATC
TCGTACCATCCATCGATGGATCCATCAGCTTCCTTATTGGTTTATTCGTCGCTGTACGTACATGCATCTCGTACCATCCATCGATGGATCCATCAGCTTCCTTATTGGTTTATTGTTTGG
TTGTTGAATAATATATATAATGAAGGGGTGCGACGCGTCGATCCTGCTGGACGGGCCCAACACGGAGAAGACGGCGGTGGAGAACAGTGGCATCTTCGGCTACGACTTCATCGACGACGT
CAAGACGGCGCTCGAGAGGGCGTGCCCCGGCGTCGTCTCTTGCGCAGACATCATCATCGCCGCAACAAGGGACGCCGTTGGCATG
GTGAGTGAGTGATGGGTGAGAGTGACGAGCCCCAC
TGTATGCTAATCAAGAGCGCTGCCAACAAGCAATATATATATATATATATATACCGTCTGAAAGTGCGTGATGATCTAGCTATTTGCATTATATTGTGAACAAATGATTATTAATTAGCG
TAAAAATGTCGTCTGTGCGTGCAAAAATGCAAGTCCAGTGCGGAGGGCCGAGCTACCAAGTGCAACTGGGCAGGAGGGACGGCATGGTGTCGCAAGCGTCAATGGCGAGCATTCTTCCGG
GCCCCGGCGTCGACATCCCCACCGCTATCAACCTATTCGCGCGGAAGGGCCTCAACAGCTTCGAGATGGTCAGCCTCATGG
GTACGTCGCCGCCGGCCGCCTATGCTACGTATTACGTTG
CAATTAATCTTTACTAATTCTTACAACTGATGCTGAAAGTTTTACCATGCATGACCCACGTGCATGCCCTCTCCTCGGACTGGTCTTTTGACCTAGCTAGAACACAGCTAAGCGTATTGA
TTCTATGTGCATATACCAAGCAGCTCAACGCATGGAATATCACGATACACCAGTGCTGGCAGATAAAATAAGCAGTTAGTATATCTAGATATGCGTTAATCTATTGGGCTAGTTTATTTG
CTGGTCTAACGTTATACACGTACTACTATATATTATTTCTTGTGATCTTATAATCATATTTATTACGTTATTCCCCCCTTTCAATGTGCCCCCATCATGATCACCCAGCTTAGCACAGCT
CCGCATCAAAACCGTTCGAAGTTTCTTTACATGTCAATGCTGAATAATTTCTTCTGATCGAGATCTCGGAATTAGAGCACATATATGATATATATAGGCAAGTGAGTTACTTTAGAGCAA
GTGTCCAGCTAATCATATGCCCAACACACAAACTACTAGGCATCAATACAATACAATGCAACTTGATTGCATCGTTCGTGTACATCTCTCATGTATAACACTAGCTTTATTTAAAATTTC
CTTTTCCAGCCAGTTTACCCATAAGTAACTACAGTGTATATACTGAATTTTTTAAGCGCGCGCCAGTAGTTTTTCCTTACAAATAATCCCCCCGGTCGTGTTAATTTCGTTTCCTCGCAG

GCGCGCACACGGTGGGGGTGACACACTGCTCCGTGATCCACGACCGGCTGTTCAACTTCAACGGCACCGGCTTGCCGGACCCGGCCATGGACCCGGTGTACGTGTGGATCCTGTCGACGT
TCGCGTGCCCCAAGGGCCAGGCCTTCGACAACATCGTCTACCTGGACGACCCCTCCAGCATCCTCCTCGTCGACAAGAGCTACTACTCGCAGATCATGAAGCGCCACGGCGTGCTGTCCG
TGGACCAGGCCCTCGGCGACCACAGCGCCACCGCGTGGATGGTGAGGTTCCTCGCCACCACCGACTTCTTCCCCTCCATGTTCAGCTACGCGCTCAACAAGCTCGCCGCGCTCGACGTCC
TCACCGGCACCGCCGGCGAGATCCGGAGTAACTGCCGGAGGACCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCCGGCCTGCTCCGCCGCGCTGCTCGCCGCCTTCCTCGTCGTGCTGGCTTGTTCAGCCGTGAGCTGCCGCGGTCAGCTGGCCGACAACTTCTACGCCGGCAAGTGCGGCAACTTC
AGCGTGGAGGCCATCATCCACGACGCCGTCAAGGCGCGGCTCGCGTGGGACAAGAGGATGGTCGCCGGCCTCCTCCACCTGCAGTTCCACGACTGCTTCGTCGCT
GGGTGCGACGCGTCG
ATCCTGCTGGACGGGCCCAACACGGAGAAGACGGCGGTGGAGAACAGTGGCATCTTCGGCTACGACTTCATCGACGACGTCAAGACGGCGCTCGAGAGGGCGTGCCCCGGCGTCGTCTCT
TGCGCAGACATCATCATCGCCGCAACAAGGGACGCCGTTGGCATG
TGCGGAGGGCCGAGCTACCAAGTGCAACTGGGCAGGAGGGACGGCATGGTGTCGCAAGCGTCAATGGCGAGCATT
CTTCCGGGCCCCGGCGTCGACATCCCCACCGCTATCAACCTATTCGCGCGGAAGGGCCTCAACAGCTTCGAGATGGTCAGCCTCATGG
GCGCGCACACGGTGGGGGTGACACACTGCTCC
GTGATCCACGACCGGCTGTTCAACTTCAACGGCACCGGCTTGCCGGACCCGGCCATGGACCCGGTGTACGTGTGGATCCTGTCGACGTTCGCGTGCCCCAAGGGCCAGGCCTTCGACAAC
ATCGTCTACCTGGACGACCCCTCCAGCATCCTCCTCGTCGACAAGAGCTACTACTCGCAGATCATGAAGCGCCACGGCGTGCTGTCCGTGGACCAGGCCCTCGGCGACCACAGCGCCACC
GCGTGGATGGTGAGGTTCCTCGCCACCACCGACTTCTTCCCCTCCATGTTCAGCTACGCGCTCAACAAGCTCGCCGCGCTCGACGTCCTCACCGGCACCGCCGGCGAGATCCGGAGTAAC
TGCCGGAGGACCAACTGA

Retrieve as FASTA