Entry information : EguPrx65
Entry ID 11524
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-01-22 (Qiang Li)
Sequence status partial
Reviewer Christophe Dunand
Last annotation changes 2016-02-05 (Christophe Dunand)
Peroxidase information: EguPrx65
Name EguPrx65
Class Class III peroxidase     [Orthogroup: Prx008]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx65
start..stop
S start..stop
EgrPrx65 503 0 1..250 74..323
EguPrx66 475 5e-172 1..250 74..323
EgrPrx66 475 6e-172 1..250 74..323
EglPrx66 475 6e-172 1..250 74..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5874..6065 192 N° 2 6158..6326 169 N° 3 6406..6794 389  
join(5874..6065,6158..6326,6406..6794)


exon

Literature and cross-references EguPrx65
Protein sequence: EguPrx65
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   26390.3  
PI (pH):   %s   9.04
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCDGSILLDDTSSFQGEKTAGPNNKSLRGYNVIDRIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASFSLANSGALPPPTSTLSNLTSLFQAQGLSTRDMVALSGSHTIGQARCISFRSRIYNDSNIDSPFSKTRQGKCPSTVGSGDQNLAPLDLQSPTAFDNAYFKNLLSNKGLLHSDQELFNGGSTDSLVKTYSNNPKTFNSDFASAMIKMGDIKPLTGSKGEIRKICSKV

Retrieve as FASTA  
Remarks Partial sequence from genomic (exon 1 is missing).
scaffold_2_6559 (5874..6794)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGTGCGATGGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGTG
GAGTCCGCCTGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTCCTA
GTATGTGTTGCAANCGATATAGCTANTTGCGCCTTTAGTCTGAGCTCC
TAATTTACTCTTATTATCAATTGATGGTGATGGGATATTTGAAGCTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCGAGGACCGCGAGCTTCTCACTCGCCAACAGCG
GAGCCCTTCCCCCTCCAACTTCAACGCTCTCCAACCTCACCTCTCTTTTCCAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCTCTGG
CCTCGCTCAGTTGCTAGGTTGCTCATGGGTCATGCATGGGCGTGCATTGCAGGGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGAAGTCGCATATACAACGACAGCAACATC
GACAGCCCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCAGCACCGTTGGGTCTGGGGACCAAAACCTGGCTCCTCTCGACCTCCAATCTCCCACCGCCTTCGACAACGCCTACTTCAAG
AACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAATGGCGGATCCACCGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCCGATTTTGCT
TCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGCAAGATCTGTAGCAAGGTCAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGTGCGATGGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGTG
GAGTCCGCCTGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTCCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCGAGG
ACCGCGAGCTTCTCACTCGCCAACAGCGGAGCCCTTCCCCCTCCAACTTCAACGCTCTCCAACCTCACCTCTCTTTTCCAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCT
G
GGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGAAGTCGCATATACAACGACAGCAACATCGACAGCCCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCAGCACCGTTGGG
TCTGGGGACCAAAACCTGGCTCCTCTCGACCTCCAATCTCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAAT
GGCGGATCCACCGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCCGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGC
GAAATTCGCAAGATCTGTAGCAAGGTCAAT

Retrieve as FASTA