Entry information : EguPrx66
Entry ID 11525
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2012-12-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-05 (Christophe Dunand)
Peroxidase information: EguPrx66
Name EguPrx66
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx66
start..stop
S start..stop
EgrPrx66 662 0 1..323 1..323
EglPrx66 662 0 1..323 1..323
EcamPrx66-1 660 0 1..323 1..323
EgrPrx65 615 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5137..5355 219 N° 2 5823..6014 192 N° 3 6107..6275 169 N° 4 6355..6743 389
join(5137..5355,5823..6014,6107..6275,6355..6743)


exon

Literature and cross-references EguPrx66
Protein sequence: EguPrx66
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   34484.45 (31744.1) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.93 (9.80) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRHPIWVIVAMAFVTTLGWGSASAQLSTNFYSKSCPNVLSTAKSVVQSAVSKERRMGASLLRVFFHDCFVNGCDGSILLDDTSSFQGEKTAGPNQNSVRGYNVIDQIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASLSRANSGVIPPPTSTLSNLISRFKAQGLSTRDMVALSGSHTIGQARCISFRPRIYNDSNIDSSFSKTRQGKCPRTAGSGDNNLSPLDLQSPTAFDNAYFKNLLSNKGLLHSDQELFNGGTTDSLVKTYSNNPKTFNSDFASAMIKMGDIKPLTGSKGEIRKICSKI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). scaffold_2_6560
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTT
TTGAGCACGGCGAAATCTGTTGTCCAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCGTCTTCTTTCATGATTGCTTCGTCAAT
GTAATCTTTCCTTCCTCCCTC
CCTTTTTCCCAAATTTCTACCTGTTCCCTACATATACTTCCCGGCCACAGCCATTTTTACCATTAAAAACCCGAGTCTTATGTTGTAAACGATGCAAAAGAGCATGCATAATAATTCCAC
TATAAAGGTTGTCTATGACCATTTCTATGAATACACTGGCTTTCTTTCTTTTTGAATAAAAAAAAAAGGCCGATTTGGACATTGAAAAATAATGTGATGGCATTCATGCAAACTGGTCTA
CGCATATAGAGTTACTTAAGATGATTTGAAAATTAAGTGACTCAGAGTCCACTACAATGCATAAGGCTTTATCAGCCGTTCAATGTTTAATACGTGTGAACTTCTCTAGGGGGAATCACT
AACTTTTTAGTAGATTATCGATGAGTTTGTCACGTTCAAAGACATGCATGGTTTGACATGGTTAGTTTTGCATCGACCAAAAATAGGGGTGCGACGGCTCGATACTCCTGGATGACACAT
CCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTGGTCTCTTGTGCAG
ACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTGCTA
GTATGTATTGAAATTGATATGGCTAGTTGTTCATTTAGTCTGAGCCCCTAAATTGCTGTTATTATCAATTGATGGTGATGTG
ATATTTGAAGCTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCCAACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCTCCAA
CCTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACTAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCCCTGGCCTCGCTCAGTTGCTAGGTTGCTCATGGGTCGTG
CATGGGCGTGCATTGCAGGGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGT
GCCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCTCCTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGG
ACCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCC
TCACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGCAAGATCAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTT
TTGAGCACGGCGAAATCTGTTGTCCAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCGTCTTCTTTCATGATTGCTTCGTCAAT
GGGTGCGACGGCTCGATACTC
CTGGATGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTG
GTCTCTTGTGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTGCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCC
AACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCTCCAACCTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACTAGGGACATGGTTGCCTTGTCTG
GGTCTCACACCATAGGTCAG
GCAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCT
CCTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTC
GTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGC
AAGATCAAT

Retrieve as FASTA