Entry information : EguPrx76
Entry ID 11533
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-01-22 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-21 (Christophe Dunand)
Peroxidase information: EguPrx76
Name EguPrx76
Class Class III peroxidase    [Orthogroup: Prx049]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx76
start..stop
S start..stop
EglPrx76 675 0 1..329 1..329
EgrPrx76 675 0 1..329 1..329
EcamPrx76 628 0 26..329 1..304
PtPrx83 470 3e-168 18..329 27..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2941..3150 210 N° 2 3441..3632 192 N° 3 3826..3991 166 N° 4 4421..4839 419
join(2941..3150,3441..3632,3826..3991,4421..4839)


exon

Literature and cross-references EguPrx76
Protein sequence: EguPrx76
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (310)
PWM (Da):   %s   36495.18 (34666.1)  
PI (pH):   %s   4.62 (4.62) Peptide Signal:   %s   cut: 20 range:20-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVLLXVLLLLSLYGVGTSGGEGALVLGYYQEKCPLLEEIVRHSVERAVYREPRMAASLLRVHFHDCFVMGCDASVLLDSFDGMVSEKQAVPNLNSLRGFEVIDEIKYNLEEACPYTVSCADILAIVARDAVELRGGPRWEVWLGRRDSLKASFDGANKFIPAPNSSLEALIANFGQQGLDERDLVALSGSHTMGKARCLSFRQGIYEESTERQYDPFQRYTTFYDTLQSICPETGSDNRLALLDHVTPFEFDNHYFLNLLQGTGLLPSDNALINEDHEGVISRLVWTYASDTEAFFRDFANSVVKMGNINVLTESGGEIRRTCRFIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
scaffold_4_14081 (2941..4839)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTATTATTGAGNGTGTTGCTACTTTTGAGTTTGTACGGAGTGGGCACTTCAGGTGGTGAAGGGGCTCTCGTTCTTGGGTACTACCAAGAGAAGTGCCCTCTGTTGGAAGAAATC
GTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTGTCCATTTTCACGACTGTTTCGTCATG
GTTAGAGGAACATCTCTCTCTCAATCTCTT
GCGCGCCCTCTCTTGGGTGACACTGTAAATGATTTACAATATCCTATTGATTTGTGAAGTTGCAGTACTTGAATGTACACAGCAACTAGAAAATGTCTCATAAATTGACATTAGAGATTT
CCATCAGTTCATCTGCCTAAATAAACCAGAACATGAGACNGTCCTTTTTAACTTTTCGTGGGAAAAGTAATTAGTATTTTCATTTTCCAGCCGCATCTTCTCTATGGGCTAACATCTNGT
GTCATTCTTTTGAGGATTAGGGTTGCGATGCATCAGTTCTTCTAGACAGCTTTGATGGCATGGTGAGCGAGAAGCAGGCAGTGCCTAACCTTAACTCCTTGCGTGGGTTCGAGGTGATTG
ACGAGATAAAGTATAATCTGGAAGAGGCGTGTCCATACACAGTCTCCTGTGCTGATATTTTGGCCATTGTTGCTCGAGATGCAGTCGAGCTG
GTAAGTAACTCAGGAAGCCATTTCTGAT
TGGAAAAATTTTAGTAGCCAGATACATTGTATGTTCACGTCATGTGTCGGTCAATCAAGATTTCCATTTCTGATGGACTCGTTCTTACTCTAAACCTAACCTTTCTCTAGTACGTCCACG
CTTAGCATCATATACACTGAGAAATTTCTTATCTCTGTGAAAAAGAGAGGAGGGCCCAGGTGGGAAGTGTGGCTAGGCAGGAGAGACTCACTCAAGGCAAGCTTTGATGGAGCCAACAAA
TTCATACCTGCTCCAAATTCCTCCCTTGAAGCCCTAATTGCTAATTTCGGGCAACAGGGCCTGGACGAAAGAGACTTGGTTGCCTTATCAG
GTGAAGTGTTTAGATTTAATTGAGTTCAA
AAGTGAAATTTCTCGCATTACAAAAAAATGGGTAATCCTTTGTTTGTAACTATTCTTGCCAAATCAATAGATTTATATTAGTTACTCATATAAAGAAGTTGGCTATGTCATCACATAAAG
TGTCTCAAAAGTTAAAAACAGCTTGAAACGAATCGCTAATGGTTTTAAGAGCTCGAAATAGTTCTCCTAATTCTCATCTCGAGTACAATTTTTTGATGCCGTGATCTTTTGTATATTTGG
CCTTTCCTCTATATATTTATTGCTTTTACCAAAAAAAAAAAAGTTCTCCTAATGTGCTTCAGTACGATGACTTTCACCTAAGCATACCATCAGTTTCTTCTTCCTCCTCCCATTTTTTCT
CAGTTAACACCGTTTTGTACGTNGAAAACTACGGAAGCAGGTAGTCACACGATGGGAAAAGCACGATGCCTGAGCTTCAGGCAAGGGATTTACGAGGAAAGCACTGAACGACAGTACGAT
CCCTTCCAGAGATACACCACCTTCTACGATACCCTACAGTCCATATGCCCCGAGACCGGAAGTGATAATAGATTAGCATTGCTTGATCACGTGACGCCTTTCGAGTTCGACAACCACTAC
TTCCTTAACCTCCTCCAAGGCACGGGTCTCCTACCATCTGATAATGCCCTCATCAATGAAGACCATGAAGGTGTTATTTCGAGGCTTGTCTGGACTTATGCCTCGGATACAGAGGCTTTC
TTCCGCGACTTTGCGAACTCGGTTGTGAAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGATCAGGAGAACATGTCGATTCATCAACACT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTATTATTGAGNGTGTTGCTACTTTTGAGTTTGTACGGAGTGGGCACTTCAGGTGGTGAAGGGGCTCTCGTTCTTGGGTACTACCAAGAGAAGTGCCCTCTGTTGGAAGAAATC
GTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTGTCCATTTTCACGACTGTTTCGTCATG
GGTTGCGATGCATCAGTTCTTCTAGACAGC
TTTGATGGCATGGTGAGCGAGAAGCAGGCAGTGCCTAACCTTAACTCCTTGCGTGGGTTCGAGGTGATTGACGAGATAAAGTATAATCTGGAAGAGGCGTGTCCATACACAGTCTCCTGT
GCTGATATTTTGGCCATTGTTGCTCGAGATGCAGTCGAGCTG
AGAGGAGGGCCCAGGTGGGAAGTGTGGCTAGGCAGGAGAGACTCACTCAAGGCAAGCTTTGATGGAGCCAACAAATTC
ATACCTGCTCCAAATTCCTCCCTTGAAGCCCTAATTGCTAATTTCGGGCAACAGGGCCTGGACGAAAGAGACTTGGTTGCCTTATCAG
GTAGTCACACGATGGGAAAAGCACGATGCCTG
AGCTTCAGGCAAGGGATTTACGAGGAAAGCACTGAACGACAGTACGATCCCTTCCAGAGATACACCACCTTCTACGATACCCTACAGTCCATATGCCCCGAGACCGGAAGTGATAATAGA
TTAGCATTGCTTGATCACGTGACGCCTTTCGAGTTCGACAACCACTACTTCCTTAACCTCCTCCAAGGCACGGGTCTCCTACCATCTGATAATGCCCTCATCAATGAAGACCATGAAGGT
GTTATTTCGAGGCTTGTCTGGACTTATGCCTCGGATACAGAGGCTTTCTTCCGCGACTTTGCGAACTCGGTTGTGAAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGATC
AGGAGAACATGTCGATTCATCAACACT

Retrieve as FASTA