Entry information : ZmPrx90 (Peroxidase 1)
Entry ID 1158
Creation 2006-06-05 (Christophe Dunand)
Last sequence changes 2006-06-05 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx90 (Peroxidase 1)
Name (synonym) ZmPrx90 (Peroxidase 1)
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx90
start..stop
S start..stop
SbPrx145 553 0 26..338 22..329
SiPrx30 548 0 26..338 22..329
SiPrx31 545 0 27..338 21..328
SbPrx129 541 0 7..338 9..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 120913127..120913363 237 N° 2 120913449..120914228 780  
join(120913127..120913363,120913449..120914228)


exon

Literature and cross-references ZmPrx90 (Peroxidase 1)
Literature Hunter,B.G. et al., unpublished
Protein ref. UniProtKB:   B6SIA9
DNA ref. GenBank:   AC197533.2 (116963..118061)
mRNA ref. GenBank:   EU952474
Protein sequence: ZmPrx90 (Peroxidase 1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (306)
PWM (Da):   %s   36533.57 (33289.7) Transmb domain:   %s   i12-34o
PI (pH):   %s   7.47 (6.98) Peptide Signal:   %s   cut: 33 range:33-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATNKPFAVNKLLPVVALLLLLAACSSPVVVAQLVAGYYSKTCPDVEEIVRDEMEKIISAAPSLAGPLLRLHFHDCFVRGCDASVLLNSTEGNLAERDAKPNKSLRGFGSVERVKARLEAACPGTVSCADVLTLMARDAVVLAKGPFWPVALGRRDGRASSATEAADHLPPAYGDVPLLTRIFSSKGLGVKDLAVLSGAHTLGTAHCPSYADRLYNFSSAYDSDPSLDTAYADRLRSRCKSVHHDDKDKAILSEMDPGSYKTFDTSYYRHVAKRRGLFQSDAALLADATTREYVHRIATGKFDDVFFNDFAESMTKMANVDVLTGAEGEIRKKCYIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, intron 1) and 5 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTAATAAGCCTTTTGCAGTTAATAAGCTGCTGCCAGTTGTGGCCCTCCTGCTCCTCCTCGCAGCATGTAGCTCACCGGTGGTGGTGGCTCAGCTGGTCGCCGGCTACTACAGC
AAAACATGCCCGGACGTCGAGGAGATCGTCCGCGACGAGATGGAGAAGATCATCTCGGCTGCACCCAGCCTTGCTGGCCCGCTCCTCAGGCTGCATTTCCACGACTGCTTCGTCAGG
GTA
AGTTCACTACCTAATTGTAAACTATGCTTTTTTGGCCACCATAGAAGTAGAACCGACAGAAATGTAAACTACCTAATTGCAGGGCTGTGACGCCTCTGTGCTGCTCAACTCTACGGAGGG
CAACCTGGCGGAGAGGGACGCGAAGCCGAACAAGAGCCTCCGGGGATTCGGTTCCGTGGAGAGGGTGAAGGCCAGGCTGGAGGCCGCCTGCCCCGGCACCGTTTCCTGCGCGGACGTCCT
CACCCTCATGGCCCGCGACGCCGTCGTGCTTGCCAAGGGGCCATTCTGGCCAGTCGCGCTGGGGAGGAGAGACGGCCGTGCGTCCAGCGCGACGGAGGCGGCCGACCATCTGCCTCCAGC
TTACGGAGACGTGCCCCTGCTCACCAGGATCTTCTCTTCCAAGGGCCTCGGCGTCAAGGACCTCGCCGTCCTCTCCGGCGCCCACACGCTAGGCACGGCGCACTGCCCCTCCTACGCCGA
CCGCCTCTACAACTTCAGCAGCGCCTACGACTCGGACCCGTCCCTCGACACCGCGTACGCCGACCGGCTCAGGTCGCGCTGCAAGAGCGTCCACCACGACGACAAGGACAAGGCCATTCT
GTCCGAGATGGATCCCGGCAGCTACAAGACCTTCGACACCAGCTACTACCGACACGTCGCCAAGCGCCGGGGGCTCTTCCAGTCCGACGCCGCGCTCCTCGCCGACGCCACCACTAGGGA
GTACGTCCACCGTATTGCCACCGGCAAGTTTGACGACGTGTTCTTCAACGACTTCGCCGAGTCCATGACCAAGATGGCCAACGTCGACGTGCTCACCGGTGCCGAGGGGGAGATCAGGAA
GAAATGCTACATCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTAATAAGCCTTTTGCAGTTAATAAGCTGCTGCCAGTTGTGGCCCTCCTGCTCCTCCTCGCAGCATGTAGCTCACCGGTGGTGGTGGCTCAGCTGGTCGCCGGCTACTACAGC
AAAACATGCCCGGACGTCGAGGAGATCGTCCGCGACGAGATGGAGAAGATCATCTCGGCTGCACCCAGCCTTGCTGGCCCGCTCCTCAGGCTGCATTTCCACGACTGCTTCGTCAGG
GGC
TGTGACGCCTCTGTGCTGCTCAACTCTACGGAGGGCAACCTGGCGGAGAGGGACGCGAAGCCGAACAAGAGCCTCCGGGGATTCGGTTCCGTGGAGAGGGTGAAGGCCAGGCTGGAGGCC
GCCTGCCCCGGCACCGTTTCCTGCGCGGACGTCCTCACCCTCATGGCCCGCGACGCCGTCGTGCTTGCCAAGGGGCCATTCTGGCCAGTCGCGCTGGGGAGGAGAGACGGCCGTGCGTCC
AGCGCGACGGAGGCGGCCGACCATCTGCCTCCAGCTTACGGAGACGTGCCCCTGCTCACCAGGATCTTCTCTTCCAAGGGCCTCGGCGTCAAGGACCTCGCCGTCCTCTCCGGCGCCCAC
ACGCTAGGCACGGCGCACTGCCCCTCCTACGCCGACCGCCTCTACAACTTCAGCAGCGCCTACGACTCGGACCCGTCCCTCGACACCGCGTACGCCGACCGGCTCAGGTCGCGCTGCAAG
AGCGTCCACCACGACGACAAGGACAAGGCCATTCTGTCCGAGATGGATCCCGGCAGCTACAAGACCTTCGACACCAGCTACTACCGACACGTCGCCAAGCGCCGGGGGCTCTTCCAGTCC
GACGCCGCGCTCCTCGCCGACGCCACCACTAGGGAGTACGTCCACCGTATTGCCACCGGCAAGTTTGACGACGTGTTCTTCAACGACTTCGCCGAGTCCATGACCAAGATGGCCAACGTC
GACGTGCTCACCGGTGCCGAGGGGGAGATCAGGAAGAAATGCTACATCGTCAACTAA

Retrieve as FASTA