Entry information : AtPrx23 (At2g38390 / PER23 / AtperoxP23 / ATP34)
Entry ID 116
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtPrx23 (At2g38390 / PER23 / AtperoxP23 / ATP34)
Name (synonym) AtPrx23 (At2g38390 / PER23 / AtperoxP23 / ATP34)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Mixed tissues
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx23
start..stop
S start..stop
AlyPrx23 662 0 1..349 1..349
AruPrx23 644 0 1..349 1..349
AhalPrx38 642 0 1..349 1..349
CrubPrx39 637 0 1..349 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16079726..16079953 228 N° 2 16080097..16080288 192 N° 3 16080387..16080555 169 N° 4 16080921..16081381 461
join(16079726..16079953,16080097..16080288,16080387..16080555,16080921..16081381 )


exon

Literature and cross-references AtPrx23 (At2g38390 / PER23 / AtperoxP23 / ATP34)
Literature Efetova M, Zeier J, Riederer M, Lee CW, Stingl N, Mueller M, Hartung W, Hedrich R, Deeken R.. A central role of abscisic acid in drought stress protection of Agrobacterium-induced tumors on Arabidopsis. Plant Physiol. 2007 Nov;145(3):853-62.
Protein ref. UniProtKB:   O80912
DNA ref. Phytozome 11:   Chr2 (16079726..16081381)
mRNA ref. GenBank:   NM_129395
Cluster/Prediction ref. Phytozome Gene 11:   19638178 UniGene:   At.28466
Omic ref. AtProteome:   At2g38390 ATTED-II:   At2g38390 e-FP Browser:   At2g38390 ePlant:   At2g38390 Genevestigator:   At2g38390 TAIR:   At2g38390
Protein sequence: AtPrx23 (At2g38390 / PER23 / AtperoxP23 / ATP34)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (320)
PWM (Da):   %s   37963.24 (35149.9)  
PI (pH):   %s   8.08 (8.20) Peptide Signal:   %s   cut: 30 range:30-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFSSSLSCSAMGALIVGCLLLQASNSNAQLRPDFYFRTCPPIFNIIGDTIVNELRTDPRIAASLLRLHFHDCFVRGCDASILLDNSTSFRTEKDAAPNKNSVRGFDVIDRMKAAIERACPRTVSCADIITIASQISVLLSGGPWWPVPLGRRDSVEAFFALANTALPSPFSTLTQLKTAFADVGLNRPSDLVALSGGHTFGKAQCQFVTPRLYNFNGTNRPDPSLNPTYLVELRRLCPQNGNGTVLVNFDSVTPTTFDRQYYTNLLNGKGLIQSDQVLFSTPGADTIPLVNQYSSNTFVFFGAFVDAMIRMGNLKPLTGTQGEIRQNCRVVNPRIRVVENDDGVVSSI

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 2, 3 introns), 4 cDNA and 17 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATACAAATC ATCTAGCACG TGATTTTTCA ATTTTAACTG AGTTGGTAAA CGACAAATCA TGTTTATCTT TAAATAAAAT CACTAATTCC ATTTATCTAA ACCTTAATGT TTTGTCAAAA  CGTTTTAGGT GGTCACACAT TTGGAAGAGC ACAATGCCAG TTCGTGACGC CTCGTCTCTA CAACTTCAAT GGTACAAACA GTCCAGACCC AAGTCTGAAC CCAACTTACC TTGTCGAACT  CCGTCGATTG TGTCCTCAAA ACGGAAACGG CACCGTTCTG GTCAACTTCG ATGTCGTGAC TCCAGATGCT TTCGATAGTC AATACTACAC CAACCTTCGT AATGGGAAAG GTCTTATTCA  GAGTGACCAG GAACTCTTTT CGACTCCAGG AGCCGATACG ATCCCTTTAG TAAACCAATA CAGCAGCGAC ATGTCCGTGT TCTTTCGAGC ATTCATTGAC GCAATGATTA GGATGGGAAA  TCTTAGACCT TTGACTGGAA CTCAAGGAGA GATTAGACAA AATTGTAGGG TTGTGAATCC ACGAATTAGG GTTGTGGAGA ACGACGATGG TGTTGTGAGT TCTATCTGAT TATGCATGTT  GCCATGTTGG GGATATATAT ATGGATATGT AAGAAAGTAT AAAATGCGCA CGTGAGAACA ATTTCGACTA ATAAAAGTTT TCACGAGTTA TGAGATTTAT GAAATTGGTA TTAAGTACAC  TTACAATGCA TATATACGTG GTGTTTATAA CACTTCAATT TCTGACATGT ATTCAAGTAG CTTTTGATTT AACATCACGT CGAAATTTAT AATATATATT CAAGCAAATT GTTGAAATAA  AATGTCCTAG TTTTTGTCAG CTTTCGTTAC TTATAAATGA GAAGAAAAGA CAAGGAGCTA AACTGCTAAA GTATTAGATT AGGTTAACTT TTGTTAACCA CAAAATCTAG CACATGGACG  CGTATGAAGT TGATAAATCA TATATGTATT AGGTAACATT GTTATTTCAG ATTAAATTGT TTTGAGCAAG AATTGTATAA AAAGTTTATC GATTTGTGAA GGTGGCTTCT GAGGCTACAT  TTGCGGGATT CACGGGGAAG AGAAGGACAA AACATAAGGA ATTCTATTTT TCATAAAATA TTAATTAGGA AGATAGTTTG AAAATGTTTG CCAATTAGGA AGGACAATCC TTTTAGAAGG  TTTTCCGAGA TTTTTTTTTT TGTCTTGTAT CCAATTATAA ATGTACGTAC CTCGTGTATA AATTAAAAAA AAAAAAGTTT AAACATTCCT TTGAAACTAC AACAAACTCA TTTATACAAA  TATCCGTCCC CTCAAAAATT CAGATATATC AACAAGAACA CGTCACAAAT AAAACGTAAT TATGGTAACA TGATGATATT ATATTTTCCT ACATAGACAT AACTTGTGTC TAACATGAAT  CAACAAACAT ATCTTTTACG ACCCTACATA ATCCAAAATT GATATCAAAT ATCGTACTAA TTTCATTTTC CGTACCACTG TTGAAATTTG TGTCGTTTAT AAATTATTTA TCAAACTTGA  AAAATATCTA AGAATAAGAA TATATTGGCG GAATTGAGAA ACATTAGATA CGTACGTCGA TTTGTAGTAA GTAAAAAATG TAGGGGAGAC GGTTCTAAAA AGTTGTAATT GAAGTTAAAA  TGATCAATCT TACTTGATTT ATCACAGCGT CGGACAAATA CAGCCAAACA CTACGAGCAA GTTTAATTCT GTCCAAAGAA TATATAGCAC GTCGAAATTA GTTTATTTTA AATTCTAATT  ATTATTTATC CTTCAACCAC TCTAGTAAAA CACATGGCCT TAAAAAAAGA CCTAATAGTA TTTTTTAAGA ACACAATACC TAATAGTCTA AAATACCATT AAAGAAAGAC TCGAACATCT 
CTATATAGTG TTCCTTCTAG GCCCTTAGTT AATACACACA CTCACAACTC AAATCATCTT TTTGTCTCCC TCCTGAAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTATGCATGT TGGGGATATA TGGATATGTA AGAACGTATA AAATGTGTGG GATTGTGGGA ACATTTCGAC TAAATAAAGT TCTCACAAGT TGTGTGATTT ATGAAATTTG GTCTTAATTA  ACACTTTTGA TTCGATTTTC TGAGTACTAA AAAAGTGGAT GAATTTCATA ATGAAATGAT ACGTGGTGTT TGTATAACAC TTAACTTTCA ATTGACATAG TTTCATGTTA TTGGAGAAGT  TAAATTGTGT GTAAAAATAT AATTCGAACA TGCATCCATT TCTATAAATA AATATCGAGG TTATCGGATT AAACAAAGCT TGTAGGACCT AAATATAGTC ATGAAACTAC AACCCTAATA  GAAGTTTCAA ACATAATCAA ACTTTAGTCT TGAGCAAAGA AATAGAAAAT ATATAAAAGT TATACTCTTG TAAGCAAAGA AAAGCCCAAA CGAAGCAAAA CAAGACAAAA AGCCCAGTTT  AAAGTAGATG TAAGCAGATT TACTTGCTAC ATCATCAACT CCCCATTTTA CATCGTCCCA ATGAGATATA TCCACTCTTT TCATAGAATT TGATGTTTTC ACACGAATAC GAAATCCCAA  ATATATAATC TATCCCTTAT AATTCATAAT TATATACAAA AAATATGCAA TCACACAACT AGCCATTAAA TACTATATAG AAATATCACC ACTTGTCATT TCAAAACAAT ACACTAATTA  ATGTCTATAA TTCAATCCTT GTCAGATGGA GATAAGAGAG ACACAATCCA TAATTTTGTT GCTCATTCAT ATAGTTCAAG TGCGTTGGCT CACGGCAAAC ATTTTAAATT TAGACCCACG  CCGGAGAAAA TCTAATTAGA CGCATAGTTT ATTATAGTGG ATTTCATTGG GACAAACAAT ATTAGCCGCA TTTTATGTAA TATCTTTCAC TTGGAACACG TGCCCCATAC ACATATGGTC 
CCTCCATGCT TTGTACTTAT GTAGTTTTTT GTATGCTACG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTTTTCGTCTTCATTATCTTGCAGTGCTATGGGAGCCCTAATAGTGGGTTGCCTTCTGCTTCAAGCATCAAACTCTAATGCTCAGTTGAGACCTGACTTCTACTTCAGGACTTGC
CCACCTATTTTCAACATCATTGGGGATACCATCGTCAATGAGCTGCGGACTGATCCTCGTATTGCCGCGAGCCTCCTTCGGCTTCACTTCCATGACTGCTTTGTTCGT
GTAAGGACTTAC
TCAACGTATCTTTTTTGTTAGTAAAAAAAACTACGTCGTCTACTTTTACATATATATATTGAATGGAGGCTAACATCCATTTTTAATGATAAATAATGTCTTCATGTTATGTAACATATA
TGGTTTTATAGGGTTGTGATGCATCGATCTTGCTTGACAATTCCACATCATTCCGGACCGAGAAAGATGCTGCTCCAAACAAAAATTCGGTTCGAGGGTTCGATGTCATAGATAGAATGA
AAGCAGCCATTGAGAGAGCTTGCCCAAGAACAGTTTCTTGCGCAGATATTATCACCATCGCCTCTCAGATATCAGTTCTTTTG
GTATGTACATATATATACCTACATGACTTATGATATT
GATCGGGTGAAGTTAATCCAAATATATTATGAATTTGACATCAATGCTTTATATGTTATAGTCTGGCGGTCCATGGTGGCCAGTTCCGTTGGGGAGAAGAGACAGCGTAGAAGCTTTCTT
CGCTCTGGCTAATACAGCTCTTCCCTCTCCATTTTCCACTCTTACTCAACTTAAAACAGCTTTTGCTGACGTTGGCCTAAACCGCCCTTCGGATTTAGTCGCCCTCTCCG
GTAATATATA
TTTTCGTTCTTGATCTAGCTAGATACAATTCATTTTATCTATTTATAGCTAGCTAATTACAAGATGATTCATAGAATTATTTTGTATTTATAATTAGAATGATCAACTTCAATTAATCTA
TATTTAGTATTAAAAGGCGTTTTTGAGGCATATGAATTAGTTAACATGAGTTTAGTTAGAAAACCCTCTTGCTTCATCTTGAGAAAAAAGACTTAGTAGAAAACCATCTCAAACAAATAT
CTTCTACGTACCACTTGAGTTTGGATTATAAAAGGACTTGGTAGAATGAAAAAGCATGACTCATAATTAAATAAAACGTACAATGTATCTAATCCTTCATTTGTCAAAATGGTAGGTGGT
CACACATTTGGAAAAGCACAATGCCAATTCGTGACACCTCGTCTTTACAACTTCAACGGTACCAACAGACCAGACCCAAGTTTGAACCCAACTTACCTCGTTGAACTCCGTCGATTGTGT
CCTCAAAACGGAAACGGCACCGTTCTGGTTAACTTCGATTCCGTGACTCCAACTACTTTCGATAGACAATATTACACCAATCTTCTTAATGGGAAAGGTTTGATTCAGAGTGACCAAGTG
CTTTTCTCAACTCCAGGAGCTGATACGATTCCACTAGTAAACCAATACAGCAGCAACACGTTCGTGTTCTTTGGAGCATTCGTTGATGCAATGATTAGGATGGGAAATCTTAAACCTTTG
ACTGGAACTCAAGGAGAGATAAGACAGAATTGTAGGGTTGTGAATCCAAGAATTAGGGTTGTGGAGAACGACGATGGTGTTGTGAGTTCTATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTTTTCGTCTTCATTATCTTGCAGTGCTATGGGAGCCCTAATAGTGGGTTGCCTTCTGCTTCAAGCATCAAACTCTAATGCTCAGTTGAGACCTGACTTCTACTTCAGGACTTGC
CCACCTATTTTCAACATCATTGGGGATACCATCGTCAATGAGCTGCGGACTGATCCTCGTATTGCCGCGAGCCTCCTTCGGCTTCACTTCCATGACTGCTTTGTTCGT
GGTTGTGATGCA
TCGATCTTGCTTGACAATTCCACATCATTCCGGACCGAGAAAGATGCTGCTCCAAACAAAAATTCGGTTCGAGGGTTCGATGTCATAGATAGAATGAAAGCAGCCATTGAGAGAGCTTGC
CCAAGAACAGTTTCTTGCGCAGATATTATCACCATCGCCTCTCAGATATCAGTTCTTTTG
TCTGGCGGTCCATGGTGGCCAGTTCCGTTGGGGAGAAGAGACAGCGTAGAAGCTTTCTTC
GCTCTGGCTAATACAGCTCTTCCCTCTCCATTTTCCACTCTTACTCAACTTAAAACAGCTTTTGCTGACGTTGGCCTAAACCGCCCTTCGGATTTAGTCGCCCTCTCCG
GTGGTCACACA
TTTGGAAAAGCACAATGCCAATTCGTGACACCTCGTCTTTACAACTTCAACGGTACCAACAGACCAGACCCAAGTTTGAACCCAACTTACCTCGTTGAACTCCGTCGATTGTGTCCTCAA
AACGGAAACGGCACCGTTCTGGTTAACTTCGATTCCGTGACTCCAACTACTTTCGATAGACAATATTACACCAATCTTCTTAATGGGAAAGGTTTGATTCAGAGTGACCAAGTGCTTTTC
TCAACTCCAGGAGCTGATACGATTCCACTAGTAAACCAATACAGCAGCAACACGTTCGTGTTCTTTGGAGCATTCGTTGATGCAATGATTAGGATGGGAAATCTTAAACCTTTGACTGGA
ACTCAAGGAGAGATAAGACAGAATTGTAGGGTTGTGAATCCAAGAATTAGGGTTGTGGAGAACGACGATGGTGTTGTGAGTTCTATCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACACACTCAC AACTCAAATC ATCTTTTTGT CTCCCTCCTG AAAAAATGGG GTTTTCGTCT TCATTATCTT GCAGTGCTAT GGGAGCCCTA ATAGTGGGTT GCCTTCTGCT TCAAGCATCA  AACTCTAATG CTCAGTTGAG ACCTGACTTC TACTTCAGGA CTTGCCCACC TATTTTCAAC ATCATTGGGG ATACCATCGT CAATGAGCTG CGGACTGATC CTCGTATTGC CGCGAGCCTC  CTTCGGCTTC ACTTCCATGA CTGCTTTGTT CGTGGTTGTG ATGCATCGAT CTTGCTTGAC AATTCCACAT CATTCCGGAC CGAGAAAGAT GCTGCTCCAA ACAAAAATTC GGTTCGAGGG  TTCGATGTCA TAGATAGAAT GAAAGCAGCC ATTGAGAGAG CTTGCCCAAG AACAGTTTCT TGCGCAGATA TTATCACCAT CGCCTCTCAG ATATCAGTTC TTTTGTCTGG CGGTCCATGG  TGGCCAGTTC CGTTGGGGAG AAGAGACAGC GTAGAAGCTT TCTTCGCTCT GGCTAATACA GCTCTTCCCT CTCCATTTTC CACTCTTACT CAACTTAAAA CAGCTTTTGC TGACGTTGGC  CTAAACCGCC CTTCGGATTT AGTCGCCCTC TCCGGTGGTC ACACATTTGG AAAAGCACAA TGCCAATTCG TGACACCTCG TCTTTACAAC TTCAACGGTA CCAACAGACC AGACCCAAGT  TTGAACCCAA CTTACCTCGT TGAACTCCGT CGATTGTGTC CTCAAAACGG AAACGGCACC GTTCTGGTTA ACTTCGATTC CGTGACTCCA ACTACTTTCG ATAGACAATA TTACACCAAT  CTTCTTAATG GGAAAGGTTT GATTCAGAGT GACCAAGTGC TTTTCTCAAC TCCAGGAGCT GATACGATTC CACTAGTAAA CCAATACAGC AGCAACACGT TCGTGTTCTT TGGAGCATTC  GTTGATGCAA TGATTAGGAT GGGAAATCTT AAACCTTTGA CTGGAACTCA AGGAGAGATA AGACAGAATT GTAGGGTTGT GAATCCAAGA ATTAGGGTTG TGGAGAACGA CGATGGTGTT  GTGAGTTCTA TCTGATTATG CATGTTGGGG ATATATGGAT ATGTAAGAAC GTATAAAATG TGTGGGATTG TGGGAACATT TCGACTAAAT AAAGTTCTCA CAAGTTGTGT GATTTATGAA 
ATTTGGTCTT AATTAACACT TTT 

Retrieve as FASTA