Entry information : EguRboh03
Entry ID 11611
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-03-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-16 (Christophe Dunand)
Peroxidase information: EguRboh03
Name EguRboh03
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguRboh03
start..stop
S start..stop
EgrRboh03 1618 0 1..798 1..798
EglRboh03 1595 0 13..798 29..814
EgrRboh06 1154 0 13..798 51..857
EglRboh06 1150 0 13..798 51..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2932..2966 35 N° 2 3516..3724 209 N° 3 3838..4000 163 N° 4 4102..4150 49
N° 5 4232..4345 114 N° 6 4427..5233 807 N° 7 5360..5455 96 N° 8 5558..5673 116
N° 9 5765..5867 103 N° 10 6006..6097 92 N° 11 6181..6340 160 N° 12 6426..6560 135
N° 13 6661..6789 129 N° 14 6885..6963 79 N° 15 7117..7226 110  
join(2932..2966,3516..3724,3838..4000,4102..4150,4232..4345,4427..5233,5360..545 5,5558..5673,5765..5867,6006..6097,6181..6340,6426..6560,6661..6789,6885..6963,7 117..7226)


exon

Literature and cross-references EguRboh03
Protein sequence: EguRboh03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   798
PWM (Da):   %s   91615.87 Transmb domain:   %s   i245-264o331-353i381-403o429-451i617-634o
PI (pH):   %s   10.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNMLLHKTQVIGTTRKRNASYGGIPRMERTASSASRGLMSLRFLDRTITGKEGDAWRSIEKRFHQHATNGQLSRDKFGVCGMGDSKEFAGELFDALSRRRKVNAENGISIDQLRQFWEDMTTRELESRLQIFFDMCDKNGDGRLTEDEVKVIVLSAASNRLSNLQQQAASHASLIMERLDPDHQGYIEMWQLKTLLREMVNPDQRSKLSVNSQNLTRTMLPKGYRKPMSRLVHKNIERIHDNWRRIWVVGLWLVANMILFLWKFNKTRHSPAFNITGYCLCYAKGSAETLNFNMALVLLPVCRRTLTKLRSSFLGTFIPFDDNINFHKIIALAIAIGSVVHTAMHFMCNFPRITSCPKSQFMQVFGPSFHNRQPHYIDLVNNLSSTTGVLMFMMMAFSFTLATHWFRRNIIKLPLGLHHLAGFNSFWYAHHLLAVAYVFFILHGYFLVISRPWYTKTAWMYVMVPILLYTSERAFTSASELQHRVDIIKAIVYSGNVLALYMSKPPGFKYNSGMYLFVKCPDISKFEWHPFSITSAPGDAFLSVHMRALGDWTTELRNRFAVCEPPRKKPGKGGLTKMATRTSHNLEELQEKFPKIFIKGPYGAPAQDYEKYDILLLIGLGIGATPFISIIKDILNHVKXNKLQDSDQDQSSGARKGPKRAYFYWVTREQNSFEWFKGVMDDIAERDDHNVIEMHNYLTSLYEEGDARSALIAMVQKLQHAKNGVDIFSESRIKTHFARPNWRKVFSEIAMRHKSSRIGVFYCGSSVLTKTLRKLCQELSLESSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic
scaffold_6_21545 (2932..7226)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATATGCTTCTGCACAAAACGCAGGTTATTGGGTAAGTTAAATTTTATTTTTTTAGTACAAGGNATCGTAAGTTGTCCNATGGAAATTGCCGTTTTTGTAGTATTTTTACNTTGGAA
AAACATAATTTTTGTTTTCGGTTGATCTTATGAGATGTTTAAGAATCGGTTGGCTTTCCAGTTACATGGTGCAACGGCATTACTTTCAGGTGTGGTCAANAAACAATTCCAGGTACAAAA
AAGTGTTCCTCCATTGTAATGGTGTGTGTTGGTTAAAGTTGTTCCTGTTTCATTTCCTATCTTTAGGCTTTCCTCTTCCTCTTCCGCCTCTTAAAACTCACCATCTTTACTTCTCTCTTC
ATCTTTCATCCTCATACTTTTCCCAGTCACCCGAACCCTCGGAGGGAATACACCCAAAACCACAAATTGTTCATAGTTGCAATGAGGGTCCGTCATGACCGTAACGGGAGTTCCGCTAGA
TGCTCTCTTGAAAGCATTGAGATGGACAGTGCGGTGGAAACCAGTGAGAGCTCCGCCCCGCCGCATCCTAATGACATACCATTGCCATCGAAGCGGAACTCAAGCACGACGCGGAAGAGG
AATGCATCGTACGGCGGNATCCCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGCTTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGGAGATGCCTGGAGA
TCAATCGAGAAGCGTTTCCATCAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCTGCATTG
GTTGATCCTTAGAAAGTCTTGCTGCTATCTGAATCATGATTTTCCAA
ATAATAATAATAATAATAATTTCACAATTTGATTGAGAAGTGACATTGTTTTATTCTGCGTGGAAGGAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGAC
GGAGGAAAGTGAATGCCGAAAATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGACATGACGACTCGAGAACTCGAATCCCGACTGCAGATATTCTTTGATAT
GTAAAGCAACT
CTCGTCCATCTCCTATTATCGTTCGCAACCTANAGCGTACATTGCGTTGCTGGTATTACATGTGATGAAGTTTTGCGACGAATGCTGCAGGTGTGACAAGAATGGTGATGGGAGGCTAAC
TGAGGATGAGGTAAAAGAG
GTGAGGCAAAAGGAGACTTACTAATCACTCGTTTANCGTGTCCTTTGGGCTCTTTTATGATGGACTGGAAATTTTTCAAAGGTGATAGTGTTGAGCGCCGC
CTCGAATAGGCTGTCGAATCTCCAGCAGCAAGCGGCATCTCACGCATCTTTGATCATGGAAAGACTTGATCCCGACCATCAAGGATACATCGAG
GTACCAAGTCAGATAGTCCATCATGT
CCTGTTCGAGTTCGTGTTCCTCCCATGTTGTTGTTCATCGCTTCTTTGTTTTCAGATGTGGCAATTAAAGACTCTACTGAGAGAAATGGTGAACCCTGATCAAAGGAGCAAGTTGTCAGT
GAATTCTCAAAACCTGACCAGAACCATGCTTCCCAAAGGATACAGAAAACCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGGATCCATGACAATTGGAGGCGAATATGGGTCGTCGG
GCTGTGGCTGGTCGCAAACATGATCCTCTTCCTTTGGAAGTTTAACAAAACGAGGCACAGCCCCGCCTTTAACATCACGGGCTATTGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACT
CAATTTCAACATGGCTCTCGTCCTCCTCCCCGTATGCAGAAGAACTCTCACNAAGCTACGGTCGTCCTTCCTTGGTACCTTCATACCATTCGACGACAACATAAACTTCCACAAGATAAT
CGCGCTGGCCATAGCAATAGGATCTGTCGTTCACACTGCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCATGCCCAAAATCACAATTCATGCAAGTGTTTGGCCCGAGCTTCCA
TAATAGGCAACCTCATTACATCGACTTGGTCAATAACTTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCTTTCACACTGGCGACTCATTGGTTCAGGAGAAACAT
CATCAAGCTACCGTTGGGGCTCCATCATTTGGCAGGATTTAATTCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTCTTCTTCATACTCCACGGCTACTTCCTCGTGATCAG
TCGACCTTGGTACACGAAAACG
GTAAGTACACAATGGTCTAATTCCTTATTCTGTTCACCATTAATCCATAAGGCCTGAATTCTCCGGTAGTACCATCATTCCTCTGAAAACACGGCAAG
AATCATTATACGGTTGGACTTTATGCAGGCATGGATGTATGTGATGGTCCCAATCCTACTCTATACAAGCGAGAGAGCATTCACATCTGCTTCTGAACTCCAACATCGAGTTGATATCAT
TAAG
GTATCACTCACTTTACCGAACTGCCGTGTTCCACATTCCTTTTTGGTTTACACGAATCTTAGTGCTACGAGAAATTCATGCTCGGCTCAAAAAACTTTTCAGGCCATTGTTTATTC
TGGAAACGTCCTTGCATTGTACATGAGCAAGCCTCCAGGTTTCAAGTACAACAGCGGAATGTACCTTTTCGTCAAATGCCCTGATATATCAAAGTTCGAATG
GTGTATAGAACATAATCG
CTGAAACCTATTTACTCGTCATACCCCTATGGCTTTTATTGCTGAAACTCATCGGTGTTTTTGCTCGGGACAGGCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTCTTGAGTG
TTCACATGCGAGCCTTGGGCGATTGGACTACAGAGCTCAGGAATAGATTCGCCGAG
GTATATTCTATTGATTTTCTCATTCGTTTTTAGATTGCACAACGCATGGACTCTAGTCGAAAGA
TATAAAAAAATCACCACATTTTCCATGTTGAGTATCGAACTCAATGTTCATCTTCTTCAATGAGAAATTGTTAGGTTTGTGAGCCACCACGTAAAAAACCAGGGAAGGGAGGTCTAACGA
AGATGGCCACGAGAACATCCCACAACTTGGAAGAGTTACAAGAGAA
GTGAGTGAAAATTATGGCTAAATTCTGTCCCACCCCTTCCATGCAAATGCTTTCGCTCTAACAGATATTCATTG
TTGTCCAAGGTTTCCAAAGATTTTCATCAAGGGGCCATACGGTGCTCCGGCTCAGGACTACGAGAAGTATGACATCCTCCTGCTCATCGGTCTCGGCATCGGAGCGACTCCTTTCATCAG
CATCATAAAAGATATCCTGAATCACGTCAAGTTNAATAAGCTCCAAGCA
GTAAGTAGAAAAGGGAAAAACACTCGCACAAGCAAATTCAAATTCAGTTAGCACGACCATTTGCCAAAACT
ATTGATACATGCAGGATTCGGATCAAGATCAATCATCAGGGGCAAGAAAAGGTCCTAAAAGAGCATACTTTTACTGGGTTACGAGGGAACAAAACTCTTTCGAGTGGTTCAAGGGCGTCA
TGGATGATATTGCAGAAAGAGACGATCAT
GTCGGTTCGCCATTTCCAAAACTACCAAGTGTAATGAATCCTCCAATTAATTATAGTTTTTCAACTAAAATGTCGCTTTGGGTACTGGTGA
TTGTTGTAGAATGTAATAGAGATGCACAACTACCTGACCTCTCTATATGAGGAAGGAGATGCAAGATCAGCACTCATTGCCATGGTCCAAAAGTTGCAGCACGCGAAGAATGGCGTCGAC
ATCTTCTCGGAAAGTCGG
GTAACTCTTGATCAGTCACCCAAAAGAAAAACAAAGAAACATTCACAGCACAATGCACCTATTTAGGCTGTCATTTAACGTTGCTTGTTCGACAGATAAAAA
CTCACTTTGCGAGGCCTAATTGGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCTCGTATAG
GTACGACATCACGTCCGATGAACGTGTCGACATAATGGCACTTGATTT
GGTTGTGCTAGCCAGTTTGGAACATGAACCTGTGATTTTCTAACTGTTGGAACTTGAACATTCTACCAATTCGGGTCTGATATGTCGGTAATAATTTTCCTGCAGGTGTTTTCTATTGTG
GGAGTTCGGTGCTCACCAAAACACTGAGGAAGCTATGTCAAGAACTCAGCCTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATATGCTTCTGCACAAAACGCAGGTTATTGGCACGACGCGGAAGAGGAATGCATCGTACGGCGGNATCCCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGC
TTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGGAGATGCCTGGAGATCAATCGAGAAGCGTTTCCATCAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCTGC
ATTG
GAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGACGGAGGAAAGTGAATGCCGAAAATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGAC
ATGACGACTCGAGAACTCGAATCCCGACTGCAGATATTCTTTGATAT
GTGTGACAAGAATGGTGATGGGAGGCTAACTGAGGATGAGGTAAAAGAGGTGATAGTGTTGAGCGCCGCCTCG
AATAGGCTGTCGAATCTCCAGCAGCAAGCGGCATCTCACGCATCTTTGATCATGGAAAGACTTGATCCCGACCATCAAGGATACATCGAG
ATGTGGCAATTAAAGACTCTACTGAGAGAA
ATGGTGAACCCTGATCAAAGGAGCAAGTTGTCAGTGAATTCTCAAAACCTGACCAGAACCATGCTTCCCAAAGGATACAGAAAACCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGG
ATCCATGACAATTGGAGGCGAATATGGGTCGTCGGGCTGTGGCTGGTCGCAAACATGATCCTCTTCCTTTGGAAGTTTAACAAAACGAGGCACAGCCCCGCCTTTAACATCACGGGCTAT
TGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACTCAATTTCAACATGGCTCTCGTCCTCCTCCCCGTATGCAGAAGAACTCTCACNAAGCTACGGTCGTCCTTCCTTGGTACCTTCATA
CCATTCGACGACAACATAAACTTCCACAAGATAATCGCGCTGGCCATAGCAATAGGATCTGTCGTTCACACTGCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCATGCCCAAAA
TCACAATTCATGCAAGTGTTTGGCCCGAGCTTCCATAATAGGCAACCTCATTACATCGACTTGGTCAATAACTTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCT
TTCACACTGGCGACTCATTGGTTCAGGAGAAACATCATCAAGCTACCGTTGGGGCTCCATCATTTGGCAGGATTTAATTCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTC
TTCTTCATACTCCACGGCTACTTCCTCGTGATCAGTCGACCTTGGTACACGAAAACG
GCATGGATGTATGTGATGGTCCCAATCCTACTCTATACAAGCGAGAGAGCATTCACATCTGCT
TCTGAACTCCAACATCGAGTTGATATCATTAAG
GCCATTGTTTATTCTGGAAACGTCCTTGCATTGTACATGAGCAAGCCTCCAGGTTTCAAGTACAACAGCGGAATGTACCTTTTCGTC
AAATGCCCTGATATATCAAAGTTCGAATG
GCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTCTTGAGTGTTCACATGCGAGCCTTGGGCGATTGGACTACAGAGCTCAGGAAT
AGATTCGCCGAG
GTTTGTGAGCCACCACGTAAAAAACCAGGGAAGGGAGGTCTAACGAAGATGGCCACGAGAACATCCCACAACTTGGAAGAGTTACAAGAGAAGTTTCCAAAGATTTTC
ATCAAGGGGCCATACGGTGCTCCGGCTCAGGACTACGAGAAGTATGACATCCTCCTGCTCATCGGTCTCGGCATCGGAGCGACTCCTTTCATCAGCATCATAAAAGATATCCTGAATCAC
GTCAAGTTNAATAAGCTCCAAGCA
GATTCGGATCAAGATCAATCATCAGGGGCAAGAAAAGGTCCTAAAAGAGCATACTTTTACTGGGTTACGAGGGAACAAAACTCTTTCGAGTGGTTC
AAGGGCGTCATGGATGATATTGCAGAAAGAGACGATCAT
AATGTAATAGAGATGCACAACTACCTGACCTCTCTATATGAGGAAGGAGATGCAAGATCAGCACTCATTGCCATGGTCCAA
AAGTTGCAGCACGCGAAGAATGGCGTCGACATCTTCTCGGAAAGTCGG
ATAAAAACTCACTTTGCGAGGCCTAATTGGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCT
CGTATAG
GTGTTTTCTATTGTGGGAGTTCGGTGCTCACCAAAACACTGAGGAAGCTATGTCAAGAACTCAGCCTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA