Entry information : MbruAPx-CcP1
Entry ID 11621
Creation 2013-01-11 (Marcel Zamocky)
Last sequence changes 2016-02-23 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-23 (Achraf Jemmat)
Peroxidase information: MbruAPx-CcP1
Name MbruAPx-CcP1
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Dermateaceae Marssonina
Organism Marssonina brunnea    [TaxId: 698440 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MbruAPx-CcP1
start..stop
S start..stop
GclAPx-CcP01 468 2e-161 22..527 23..532
BdotAPx-CcP03 448 1e-153 5..524 2..519
GsteAPx-CcP01 435 9e-143 20..520 21..523
GdesAPx-CcP01 409 7e-138 22..524 22..527
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 191882..192013 132 N° 2 192064..193065 1002 N° 3 193113..193310 198 N° 4 193368..193622 255
join(191882..192013,192064..193065,193113..193310,193368..193622)


exon

Literature and cross-references MbruAPx-CcP1
Protein ref. UniProtKB:   K1X0J2
DNA ref. GenBank:   JH921432.1 (191882..193622)
Protein sequence: MbruAPx-CcP1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   528 (508)
PWM (Da):   %s   56182.67 (54142.7)  
PI (pH):   %s   4.25 (4.22) Peptide Signal:   %s   cut: 21 range:21-528
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSSARTICLGLCVATTTLAFPTWPDKTDELEQTMFVASGYGRRGFLDDIPTCGFSHEGPEGLGRINSAEWIRNGFHDMSTADVIAGTGGLDGSIMFETERLENDGPAFNHTLGFLGAFYGSETSISDLIALAVWAAVRQCGGPLLTMRAGRVDATEAGPYGVPEPQENITSLTDKFARQGFNSEEMIALIACGHTLGGVHGAQFPTIVPDAGTAGNNFSTFDSTTRFDNMIATEYIAGTTTNPLVVGADPALNSDARVFSLDGNATMQSLTDPAVFADTCARLLTRMIDTVPAGVVLSEPLEAYDVKPGLLNLELSEDGRNVTFTGNIRVKTTSRPRTDITSVSLLYTALDGTTGTILTRQATFQGGSATGLTDDFQHYEIFADLPASSSISSFTVSIALTNGTVETYDNNGVGYPVSSTIMLSNSRSCLRTDLPYKATIVAAVRGTFAPEDVKIVYTVPVPRQGSIIPSLVTKNATMALNSTLGDFGIYSVDVPLLVDQLNEITFDLYAGENKDYYRNAANFQSCS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTTCTTCAGCGCGAACGATCTGCCTTGGTCTCTGCGTCGCCACTACCACACTTGCCTTTCCAACATGGCCTGACAAAACTGATGAACTGGAACAGACAATGTTTGTTGCCAGCGGG
TATGGGAGAAGG
GTGAGCACCCTATTGTCATTTCATGTGCAGAGTTTTGTTGACGCGAAAAGGGCTTCCTGGACGACATACCCACTTGTGGTTTCAGTCACGAGGGACCCGAGGGATTGG
GGCGAATCAACTCCGCAGAATGGATCAGAAACGGCTTTCACGACATGTCGACGGCGGACGTGATCGCTGGGACCGGGGGCCTCGATGGATCAATTATGTTCGAGACCGAGAGACTCGAGA
ATGACGGCCCTGCTTTCAACCACACATTGGGTTTCTTGGGTGCATTCTACGGGTCAGAAACCTCCATATCAGATCTCATTGCTCTTGCGGTTTGGGCTGCCGTGAGACAATGTGGCGGCC
CTCTTCTTACTATGAGAGCCGGACGAGTCGACGCCACAGAAGCTGGACCGTACGGTGTTCCGGAACCGCAAGAAAACATCACTTCTCTCACGGACAAGTTCGCGCGACAGGGATTCAACA
GCGAAGAAATGATTGCATTAATTGCTTGCGGACACACACTTGGAGGAGTTCATGGGGCCCAGTTCCCAACCATAGTTCCCGATGCTGGGACCGCAGGGAACAACTTCTCTACCTTCGATT
CTACGACGAGGTTCGACAACATGATCGCGACTGAATACATTGCCGGAACCACAACCAATCCACTCGTTGTCGGTGCCGACCCTGCACTGAACTCCGACGCGAGGGTGTTTTCATTAGACG
GAAATGCTACGATGCAGTCGCTGACCGACCCTGCCGTATTTGCAGACACATGTGCCCGACTTCTGACGAGAATGATTGACACCGTACCGGCTGGGGTGGTCTTGTCGGAGCCTCTAGAGG
CATACGATGTCAAGCCAGGCTTGCTAAACCTCGAGCTATCCGAGGATGGAAGAAACGTCACCTTTACTGGGAACATCCGAGTGAAAACGACTTCCCGTCCCAGGACGGACATCACGTCTG
TCTCACTTCTCTACACTGCGTTGGATGGAACTACGGGGACCATCCTCACCCGACAAGCAACCTTTCAAGGCGGGTCGGCCACTGGCCTTACCGATGATTTCCAG
GTAGGTGGCCTTGAGC
TCCACTCTGAATCATGAACTGACAGGCACAGCACTACGAGATTTTCGCTGATCTCCCCGCCTCATCATCCATCTCCTCCTTCACGGTTTCCATAGCCTTGACCAACGGCACCGTCGAGAC
CTACGACAACAACGGCGTCGGATACCCCGTGTCCTCCACTATCATGCTCTCAAACAGCCGCAGCTGTCTCCGAACAGATCTCCCGTACAAAGCAACGATCGTAGCTGCT
GTAAATACCCC
TGCCCTATTCACGTTTCTCTTCTCATCGCTGATCGCTTGACAACAGGTGCGCGGCACATTCGCCCCCGAGGACGTGAAAATCGTCTACACCGTGCCAGTGCCCCGACAAGGCAGCATCAT
CCCCTCTCTCGTAACTAAAAATGCGACCATGGCCCTCAACAGTACCCTGGGGGACTTCGGCATCTACTCGGTTGACGTGCCGCTCCTCGTGGACCAGCTGAACGAAATAACCTTCGATCT
CTACGCCGGCGAGAACAAGGATTATTATCGGAACGCGGCCAATTTCCAGTCGTGCTCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTTCTTCAGCGCGAACGATCTGCCTTGGTCTCTGCGTCGCCACTACCACACTTGCCTTTCCAACATGGCCTGACAAAACTGATGAACTGGAACAGACAATGTTTGTTGCCAGCGGG
TATGGGAGAAGG
GGCTTCCTGGACGACATACCCACTTGTGGTTTCAGTCACGAGGGACCCGAGGGATTGGGGCGAATCAACTCCGCAGAATGGATCAGAAACGGCTTTCACGACATGTCG
ACGGCGGACGTGATCGCTGGGACCGGGGGCCTCGATGGATCAATTATGTTCGAGACCGAGAGACTCGAGAATGACGGCCCTGCTTTCAACCACACATTGGGTTTCTTGGGTGCATTCTAC
GGGTCAGAAACCTCCATATCAGATCTCATTGCTCTTGCGGTTTGGGCTGCCGTGAGACAATGTGGCGGCCCTCTTCTTACTATGAGAGCCGGACGAGTCGACGCCACAGAAGCTGGACCG
TACGGTGTTCCGGAACCGCAAGAAAACATCACTTCTCTCACGGACAAGTTCGCGCGACAGGGATTCAACAGCGAAGAAATGATTGCATTAATTGCTTGCGGACACACACTTGGAGGAGTT
CATGGGGCCCAGTTCCCAACCATAGTTCCCGATGCTGGGACCGCAGGGAACAACTTCTCTACCTTCGATTCTACGACGAGGTTCGACAACATGATCGCGACTGAATACATTGCCGGAACC
ACAACCAATCCACTCGTTGTCGGTGCCGACCCTGCACTGAACTCCGACGCGAGGGTGTTTTCATTAGACGGAAATGCTACGATGCAGTCGCTGACCGACCCTGCCGTATTTGCAGACACA
TGTGCCCGACTTCTGACGAGAATGATTGACACCGTACCGGCTGGGGTGGTCTTGTCGGAGCCTCTAGAGGCATACGATGTCAAGCCAGGCTTGCTAAACCTCGAGCTATCCGAGGATGGA
AGAAACGTCACCTTTACTGGGAACATCCGAGTGAAAACGACTTCCCGTCCCAGGACGGACATCACGTCTGTCTCACTTCTCTACACTGCGTTGGATGGAACTACGGGGACCATCCTCACC
CGACAAGCAACCTTTCAAGGCGGGTCGGCCACTGGCCTTACCGATGATTTCCAG
CACTACGAGATTTTCGCTGATCTCCCCGCCTCATCATCCATCTCCTCCTTCACGGTTTCCATAGCC
TTGACCAACGGCACCGTCGAGACCTACGACAACAACGGCGTCGGATACCCCGTGTCCTCCACTATCATGCTCTCAAACAGCCGCAGCTGTCTCCGAACAGATCTCCCGTACAAAGCAACG
ATCGTAGCTGCT
GTGCGCGGCACATTCGCCCCCGAGGACGTGAAAATCGTCTACACCGTGCCAGTGCCCCGACAAGGCAGCATCATCCCCTCTCTCGTAACTAAAAATGCGACCATGGCC
CTCAACAGTACCCTGGGGGACTTCGGCATCTACTCGGTTGACGTGCCGCTCCTCGTGGACCAGCTGAACGAAATAACCTTCGATCTCTACGCCGGCGAGAACAAGGATTATTATCGGAAC
GCGGCCAATTTCCAGTCGTGCTCTTAG

Retrieve as FASTA