Entry information : TocNAnPrx1
Entry ID 11625
Creation 2013-02-04 (Marcel Zamocky)
Last sequence changes 2016-02-23 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-23 (Achraf Jemmat)
Peroxidase information: TocNAnPrx1
Name TocNAnPrx1
Class Other non animal peroxidase    [Orthogroup: NAnPrx001]
Taxonomy Eukaryota Bacillariophyta Coscinodiscophyceae Thalassiosiraceae Thalassiosira
Organism Thalassiosira oceanica    [TaxId: 159749 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TocNAnPrx1
start..stop
S start..stop
MviNAnPrx01 152 2e-40 432..738 25..317
HvuNAnPrx02 111 6e-27 433..735 27..329
AqNAnPrx01 112 1e-26 456..740 56..342
HvuNAnPrx01 105 7e-25 429..736 29..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6663..6702 40 N° 2 5608..6573 966 N° 3 5061..5453 393 N° 4 4613..4963 351
N° 5 4052..4524 473  
complement(join(4052..4524,4613..4963,5061..5453,5608..6573,6663..6702))


exon

Literature and cross-references TocNAnPrx1
Literature Lommer M., Specht M., Roy A.S., Kraemer L., Andreson R., Gutowska M.A., Wolf J., Bergner S.V., Schilhabel M.B., Klostermeier U.C., Beiko R.G., Rosenstiel P., Hippler M., Laroche J. Genome and low-iron response of an oceanic diatom adapted to chronic iron limitation. (2012) Genome Biology 13: R66.
Protein ref. GenBank:   EJK59697.1 UniProtKB:   K0SMN7
DNA ref. GenBank:   AGNL01022521.1
Protein sequence: TocNAnPrx1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   79967.62  
PI (pH):   %s   4.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKRPAKKERRPFVCFSEKEAERRGRAAEVHKPLFCFQQFRQGGEDDEESQHTTALVFPQPPKAIPSAGLHTIADLTFGSASALKPSAPEAQSIDRPLVHSCKRYPIEMAAAKYLCGAAVLASAVFSANVEESTAENPSEATVLSPQHAEAAAAATPQEEEVEAGRELWGAPAWGGHYYWPPRPYYGKGGKSGGNGSWSGGKGGKSGGDDDDGWSGWSGWSGRPSWGGWPADDDGYYYGKGGKSGSYGGKGAKSGSYSDDDDGWSWGGGWPGWGPPPPRPCYCPPGKSGKTKGGKTKGRGLEAESAGGGDAEGRQLWGSPWYGPHYSGCHCGWPNYGGYGWGRPPAWGGQWVYVGGWSHHHYHHSLGKSGKSGGYDDDGYYYGDDAFNWSGDGWTGPAAPNNDEIQEVVEIYSKGGHVAGWRDDGWDNDGYYKEDIDFVRAEIVKLVEASNRELIPKFIRLGFHDCVGGCDGCIDPTDADNRGLEEAIDAISYITDKYNDSYSRADVWALATLVSADLAITGGRPDGLHFPMRYIGRKDCSGADSKGLGGPEVKMPSNDFTTHELLEFFREYFGFDTEEVVVIMGVHSVGVAHRENVGFGHIGEESGWAFNAKDYILDNRYYGMLTGGEGRDWELELAENNGGIPNRYQWVHRSGADESPIMTNSDIALVRDLQGHIVADSEGNNGLVTCGYAPTSKAPEGYPTCPMARATLELMEDYSMDNAKFLTSFGRVLAKMLKNGY

Retrieve as FASTA  
Remarks complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCGCCCAGCCAAGAAAGAAAGACGCCCCTTCGTTTGTCAAGACTGCGGGGCTTGGCTCCTCGGCAGTATTACGGAGGGTAGCGGCACTAGTCGGATCTGAAATCGAGGAAGAGTG
TTTTTCAAGGTTTTTCTGAGAAAGAGGCTGAACGTCGGGGGCGAGCGGCCGAGGTTCACAAACCGCTATTTTGCTTTCAACAATTTCGGCAGGGAGGCGAAGACGACGAGGAAAGTCAAC
ACACAACGGCCCTTGTCTTTCCGCAACCACCAAAGGCAATCCCAAGTGCTGGATTGCATACGATAGCAGATTTGACTTTTGGATCGGCGTCGGCTTTGAAACCCTCGGCACCGGAAGCTC
AGTCGATCGATCGACCGTTGGTGCATAGTTGCAAAAGGTACCCGATTGAGATGGCGGCGGCCAAATACCTGTGCGGTGCGGCTGTGCTCGCCTCCGCGGTGTTCTCGGCCAACGTCGAGG
AGTCGACGGCGGAGAACCCATCGGAGGCGACGGTGCTGTCGCCACAACATGCCGAGGCCGCCGCGGCAGCGACGCCCCAGGAGGAGGAGGTGGAGGCCGGCCGAGAGCTGTGGGGCGCCC
CCGCCTGGGGCGGTCACTACTACTGGCCGCCGAGGCCCTACTACGGCAAGGGTGGGAAGAGCGGCGGCAACGGGTCCTGGTCCGGCGGAAAGGGCGGCAAGTCAGGCGGCGACGACGACG
ACGGTTGGAGCGGGTGGAGCGGGTGGAGCGGGCGGCCCTCGTGGGGCGGCTGGCCCGCTGACGACGACGGTTATTACTACGGCAAGGGCGGCAAATCTGGCTCCTATGGAGGCAAGGGGG
CCAAGTCTGGTAGCTATAGCGACGACGACGACGGCTGGAGCTGGGGAGGCGGATGGCCAGGCTGGGGGCCTCCGCCGCCGCGGCCGTGCTACTGTCCCCCGGGCAAGAGCGGCAAAACCA
AGGGCGGCAAGACGAAGGGACGCGGCCTCGAGGCAGAGTCGGCAGGCGGTGGGGACGCTGAGGGCCGCCAGCTATGGGGTTCGCCATGGTACGGCCCACATTACAGCGGCTGCCATTGCG
GCTGGCCCAATTACG
GTAAGTCTCTTCTCCGCGACAAGCCTCTGGATTTTGGAAAATCCCCGAGCGAGCGGCTGGGACCGAGAAGACTTCCAATTCCAAGCTCCCAGTTCAATGTTCTGA
CTCTGGAGACTCACTCTTCTTCACTTTGCTTTGACTCTTTGATTCGCAGGCGGATACGGTTGGGGCAGACCGCCGGCCTGGGGAGGCCAATGGGTGTATGTGGGCGGATGGTCCCACCAC
CACTACCACCACTCATTGGGCAAGTCCGGCAAGTCTGGTGGCTACGACGATGACGGCTACTATTATGGCGACGACGCCTTCAACTGGTCGGGCGACGGGTGGACAGGTCCGGCCGCTCCG
AACAACGACGAGATCCAGGAGGTCGTCGAGATCTACAGCAAGGGTGGGCACGTCGCGGGCTGGAGAGATGACGGCTGGGACAACGATGGCTACTACAAGGAGGACATTGATTTCGTCCGT
GCCGAGATCGTCAAGCTAGTTGAGGCCTCCAACAGGGAGCTGATTCCCAAATTCATTCGGCTCGGGTTCCATGACTGCGTTG
GTAAGTACCCAGAAATCCAGGGACGAATGTAGCTTTGG
CACCGTTCTCTGTTTGAGGCTAACTACTCTCTCGCTCCCTTCCCGTGCCTTCGTCTTAGGCGGTTGCGACGGTTGCATCGACCCCACTGACGCCGACAACCGCGGCCTAGAGGAGGCCAT
CGACGCGATCTCGTATATCACCGACAAGTACAATGACAGCTACAGTCGCGCAGATGTCTGGGCCCTCGCCACGCTTGTCTCGGCCGACCTGGCTATCACCGGCGGCCGTCCTGACGGCCT
TCACTTCCCCATGAGGTATATCGGTCGTAAGGACTGCAGCGGCGCTGACTCGAAAGGGCTCGGTGGGCCCGAGGTCAAGATGCCCTCGAACGACTTCACAACACACGAACTCCTCGAGTT
CTTCAGGGAATATTTTGGTTTCGACACGGAAGAAGTTGTTGTAATAATGG
GTGAGCCTAGCAAAGAGAAAGCAAAATTCGAACCTCTCAATTAACTCGTCTAACAATCATCTTTGACCAT
GAACATCATAACGTACAGGCGTGCACTCTGTCGGTGTGGCCCACAGGGAGAACGTCGGCTTCGGTCACATCGGGGAGGAATCCGGATGGGCCTTCAACGCCAAAGACTACATCCTCGACA
ATAGATACTATGGCATGCTCACCGGCGGTGAGGGGCGTGATTGGGAACTAGAGCTCGCAGAGAACAACGGCGGGATCCCTAACAGGTACCAGTGGGTCCATAGAAGCGGCGCGGACGAGT
CCCCTATCATGACCAACTCGGACATAGCCCTAGTCCGTGACCTTCAGGGTCACATAGTGGCGGACAGCGAAGGAAACAATGGCCTTGTCACATGCGGGTACGCTCCAACGTCCAAGGCTC
CTGAGGGATACCCGACCTGTCCCATGGCGCGCGCAACATTGGAACTCATGGAGGACTACTCAATGGACAATGCTAAGTTCCTCACCAGCTTTGGGAGGGTTTTGGCCAAGATGCTGAAGA
ATGGCTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCGCCCAGCCAAGAAAGAAAGACGCCCCTTCGTTTGTTTTTCTGAGAAAGAGGCTGAACGTCGGGGGCGAGCGGCCGAGGTTCACAAACCGCTATTTTGCTTTCAACAATTTCGG
CAGGGAGGCGAAGACGACGAGGAAAGTCAACACACAACGGCCCTTGTCTTTCCGCAACCACCAAAGGCAATCCCAAGTGCTGGATTGCATACGATAGCAGATTTGACTTTTGGATCGGCG
TCGGCTTTGAAACCCTCGGCACCGGAAGCTCAGTCGATCGATCGACCGTTGGTGCATAGTTGCAAAAGGTACCCGATTGAGATGGCGGCGGCCAAATACCTGTGCGGTGCGGCTGTGCTC
GCCTCCGCGGTGTTCTCGGCCAACGTCGAGGAGTCGACGGCGGAGAACCCATCGGAGGCGACGGTGCTGTCGCCACAACATGCCGAGGCCGCCGCGGCAGCGACGCCCCAGGAGGAGGAG
GTGGAGGCCGGCCGAGAGCTGTGGGGCGCCCCCGCCTGGGGCGGTCACTACTACTGGCCGCCGAGGCCCTACTACGGCAAGGGTGGGAAGAGCGGCGGCAACGGGTCCTGGTCCGGCGGA
AAGGGCGGCAAGTCAGGCGGCGACGACGACGACGGTTGGAGCGGGTGGAGCGGGTGGAGCGGGCGGCCCTCGTGGGGCGGCTGGCCCGCTGACGACGACGGTTATTACTACGGCAAGGGC
GGCAAATCTGGCTCCTATGGAGGCAAGGGGGCCAAGTCTGGTAGCTATAGCGACGACGACGACGGCTGGAGCTGGGGAGGCGGATGGCCAGGCTGGGGGCCTCCGCCGCCGCGGCCGTGC
TACTGTCCCCCGGGCAAGAGCGGCAAAACCAAGGGCGGCAAGACGAAGGGACGCGGCCTCGAGGCAGAGTCGGCAGGCGGTGGGGACGCTGAGGGCCGCCAGCTATGGGGTTCGCCATGG
TACGGCCCACATTACAGCGGCTGCCATTGCGGCTGGCCCAATTACG
GCGGATACGGTTGGGGCAGACCGCCGGCCTGGGGAGGCCAATGGGTGTATGTGGGCGGATGGTCCCACCACCAC
TACCACCACTCATTGGGCAAGTCCGGCAAGTCTGGTGGCTACGACGATGACGGCTACTATTATGGCGACGACGCCTTCAACTGGTCGGGCGACGGGTGGACAGGTCCGGCCGCTCCGAAC
AACGACGAGATCCAGGAGGTCGTCGAGATCTACAGCAAGGGTGGGCACGTCGCGGGCTGGAGAGATGACGGCTGGGACAACGATGGCTACTACAAGGAGGACATTGATTTCGTCCGTGCC
GAGATCGTCAAGCTAGTTGAGGCCTCCAACAGGGAGCTGATTCCCAAATTCATTCGGCTCGGGTTCCATGACTGCGTTG
GCGGTTGCGACGGTTGCATCGACCCCACTGACGCCGACAAC
CGCGGCCTAGAGGAGGCCATCGACGCGATCTCGTATATCACCGACAAGTACAATGACAGCTACAGTCGCGCAGATGTCTGGGCCCTCGCCACGCTTGTCTCGGCCGACCTGGCTATCACC
GGCGGCCGTCCTGACGGCCTTCACTTCCCCATGAGGTATATCGGTCGTAAGGACTGCAGCGGCGCTGACTCGAAAGGGCTCGGTGGGCCCGAGGTCAAGATGCCCTCGAACGACTTCACA
ACACACGAACTCCTCGAGTTCTTCAGGGAATATTTTGGTTTCGACACGGAAGAAGTTGTTGTAATAATGG
GCGTGCACTCTGTCGGTGTGGCCCACAGGGAGAACGTCGGCTTCGGTCAC
ATCGGGGAGGAATCCGGATGGGCCTTCAACGCCAAAGACTACATCCTCGACAATAGATACTATGGCATGCTCACCGGCGGTGAGGGGCGTGATTGGGAACTAGAGCTCGCAGAGAACAAC
GGCGGGATCCCTAACAGGTACCAGTGGGTCCATAGAAGCGGCGCGGACGAGTCCCCTATCATGACCAACTCGGACATAGCCCTAGTCCGTGACCTTCAGGGTCACATAGTGGCGGACAGC
GAAGGAAACAATGGCCTTGTCACATGCGGGTACGCTCCAACGTCCAAGGCTCCTGAGGGATACCCGACCTGTCCCATGGCGCGCGCAACATTGGAACTCATGGAGGACTACTCAATGGAC
AATGCTAAGTTCCTCACCAGCTTTGGGAGGGTTTTGGCCAAGATGCTGAAGAATGGCTACTAA

Retrieve as FASTA