Entry information : AlaiGPx01
Entry ID 11647
Creation 2013-02-25 (Christophe Dunand)
Last sequence changes 2013-02-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-02-25 (Christophe Dunand)
Peroxidase information: AlaiGPx01
Name AlaiGPx01
Class Other glutathione peroxidase    [Orthogroup: Gpx4001]
Taxonomy Eukaryota Albuginaceae Albugo
Organism Albugo laibachii    [TaxId: 653948 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlaiGPx01
start..stop
S start..stop
PparaGPx03 389 3e-132 68..485 5..405
PiGPx03 360 2e-122 207..485 1..282
PsojGPx03 350 1e-118 207..485 1..282
PcapGPx02 342 1e-111 155..530 166..548
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 743..837 95 N° 2 4912..6408 1497 N° 3 6453..6471 19  
join(743..837,4912..6408,6453..6471)


exon

Literature and cross-references AlaiGPx01
Literature Kemen,E., Gardiner,A., Schultz-Larsen,T., Kemen,A.C., Balmuth,A.L., Robert-Seilaniantz,A., Bailey,K., Holub,E., Studholme,D.J., Maclean,D. and Jones,J.D. Gene Gain and Loss during Evolution of Obligate Parasitism in the White Rust Pathogen of Arabidopsis thaliana. PLoS Biol. 9 (7), E1001094 (2011).
Protein ref. UniProtKB:   F0WDZ3
DNA ref. GenBank:   FR824116.1 (743..6471)
Protein sequence: AlaiGPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   542
PWM (Da):   %s   60642.25  
PI (pH):   %s   4.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLHDQPSFSERDPYSCALTTVTAAQIFQRLRLRFYFLEFYRPFREDHNSIQLKMVASVSDALQGTIFERERAFIELPANVQEEAKSLFAYFISSEGKTELTKHCGSKKCKTGSFQTIKGSAFLSLVEASLKRGDDTEPKSETSAALSPTPEEIKQLAYALVFCGLLTPYKENESPIGPFSFDTELYVVVISLSAENEEGMSVWRVKEGAIQAGFLKRKGSGIFSNLRGSKKAYVIVNETQKLLGIFESDHALKTQSVIQFTAESWVEFDSNIANAIKVHNKDDSEVLIASSKEKAEEWLNACINAGAQYREAFTKNIDEVTSFYELSDFDMEHKEISMSNYKGKVLLIVNVSSMCGLTPANYTDLVALDEKYRDQGLQVLAFPCNQFANQEPGTHEEIMEFVKQYKCTFPFFEKADVNGAKARPVFMYLKAKLPGSFGNFVKWNFTKFLVDRDGKPHKRYAPKDPPLSFEDEIKTLLAAETEKVEKASTTADETVVDSNKEAKTAEKPDTTEDTQVNTAGDEAKQEESTDEEGGG

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTTACATGATCAGCCTTCATTCTCGGAAAGAGATCCCTATTCTTGCGCACTGACCACAGTCACGGCAGCACAGATTTTTCAGAGGCTCAGGTTGCGATGTGCGTGCAGGTTAGAT
CGAAGTATGTCATTTGTACTGAGCATCCATTTGAGCAATGTCCGTTTAGAGACAATGTCAATTTTGCAATTGCCGCAAGTCATCATGGGCTTTATCTCCCACATATGTTCAATTTCGAAC
AAGCTTGATGTTCCATCTTCAACTTCCGGCATGGCTTTAATGCAGATATTGTCAACCATAAAACACGCATGTATTCCTACAGCACTCCACCATCTGGCCGTCCGCTCCAACTAGACCAAT
TGATTCCATCGTAGGAGTTCTTCGACTGATACTGACTTTGGTTAACCATCAATGCGAATTACTTCAGCATTCTGACTGTACCTTGTGTTGTAACCTTCCAATTCAGCTCCATGTAATGTG
CTGTACCATTTTCTAAATCCGAAAGTAGACAGACAAAAAAATCAATCGCGGATCAAGGTCGAGCTATGACGTTCCCTGCTTGAATATTTGAAGATTCGACTTCCATTGCACCCCATGCTG
GATCTGAATCCAGAAGAAGAACTACAAGCCGCGATACGAAGCCTCAAAGACGAGAAACGGGAATGACTCATTTCGATAGATTCATGTTGTGGTGGCTTAGCGAGTAGAGAATCCCAAAGT
ACTTTTCTCGATCACAGTAGACCTTGGTAAAGATGCACGACTGTATTGTACAACACTCACATATACAGTGTTGCCTAACACACAAATTGGTGTCGAGTGGAATCTTGCATGGAAAGGATA
CTCGCTGAGTTTCACGATTTTTTGCTCCCCAATGCCCATGACAGCCAGCGTCACAGTTCCTTTTTTGCTGATTTCCATCAAAGAGGATGTGGCCAAGAGCGCTCAGATTTTCGCTTCCCG
CTCGCATGACAACGGCCCCACAAAAACATTCCGCGATCACTTCAAACGAATTTTAGTGAAAACCTGTTGCCCCTTCCTGTTTTCCCTCGTTCACTTCTTGATATCATTCAGCGAAATCCT
CGAATAGTCCAAAAAGAAGTCGCTCACGCGCACCGTAGGATACGCGCACAAGAGATCGCGGAAATTATGTTCGTCATTCTGCATCGCACTGATGAAAAGCTTCCCATCGCGCGAACGATA
GTAGAAGAGATCACCATCACGAATTACAACGATATCAAGACCGATCCGAACGACGCAAACCATCATGGTGAGAGATCTAACATTGAGTAGGTGCTTCATTAGAGTCGATGGTCCATGATT
CAAGGTGCTCAAGTGGTCGGTCCCAAACGCTCCCTCGTCAGCGTGAACAACGTAATCGGAGAAAGTTGGATTTTATTGTGCGACCGCCTGGAGCGGCTGAGCAAAATGCAGCTGATTATG
CAGCAAAACCATTTTGCAGCACAACACGGCACCAATTACAGAAGCTCTTGCACCCGCTTCCTACGGCCCACCTCTTTGCAACAGTACTCATGTACGATGCCGTTCGATCTTTCTATCCAT
GTAATCGGAGCTGACCAAGTGATGTGTCTTAGGTGGCAAAACTGCTGTACAACACTGGCATACCCACGCAGATGATATCCTGGGTTTTTATCCAAGACCTGATAAAGTATTCTAGATGGT
GCCACAGAGTCGACATGTGCAACGCGTCGTTGTGCAAATGTTTTCCTCAAAGAAACCATCTTGGAATTGTCTTCGAAGCGATAAAGATTGCTGACGGAACATCGCAGATCGGTTACTACA
ACCTACCAAATGGAAGGAAGCATTACTATACACGAGGCCAAGCCACTAAAGGATCAGCATGGCATATGGAAGGCCAGATCAAGCCGGATCATGTCACTAATTGCACGAAGAAGATGAAGA
AAAGCGCAAGGAAATTTTAATGAAACGAGCCAACGATGCTGAAAGTGATAGAGTCAAGAGTTCGAGTCGATGCACCCCACCAATTTTTTCATGATCATGCGGCTGGTGAGGGAATACGAC
GGCGGCAACGATACCAAAAGCAGCTACAACTCAAAGAGTTGCATGCCAATGAAATAGAAGCACAACAAAGGAAGAAACACTGTAATTATTCCGGAAATGGAGTTTATTGAAAGTCTTGCT
GCCGTTTCCATGCTGGCGGTACGACGTTGATAATGAAGCTTGCCGATACTGATTTTGAGAATCGGTAGCTTCGACTCTGGTCATACAAGCCAGAAAGAGTGGCTATTTGTTATTCCTTGC
ATTTGTGCCGGTATAATTGCTCCATTCGTTGCTTCTACTTCTTCATTTGGGAACCAGTTTGGAAAACTAAAGCACCAATGATAATGTTTGAGCCATTATGTATTACCGAACATCGATCAA
TAACACAGCTAATCAGATTCCGCAACACTAGTGGAGGCCTGCGAGCGATAAATGTTGCCGTAGAAAGAAGCGAAGTCTTACGCAGTTCCGATATCGCTACCGAATAGACTAACTTACCGC
AGGTCTATGATGCTATATTATATCGGTAATGTGTGTTGCTTTTGGCTGGTGAAGAAAATTGTCTGGAGGATCTCTTATTTAGATGGAACACCCCCAAAAACATGCAGTGTTCAAGTTCGC
AGTTATCGACAACGTTTCGTCGTTAAGGAGTCAGAACGTTGAATGGCTCTCGCTGGTTAAAAGTAAGAATCATACTTGTATTCATATTGATGCAAGAGAACGGCTTTGTATACCGGATGA
TGCGATCAGCTTGCAATAACGACCACGCCTGGTATCTCATGCTAAGCCACCTGTACATTGTGGAAGCTTTCAAGCATGGATTTCACAAGTGCCAGGAGGAGTAGAGCATATATGAAAGGT
TGCGCGCGTCGTACCAGCGACAACGACGATCAGTGAAGTAAACTTTCAAGTACTAATGTATTTTTCAAAGGATATGGTGCTGGCTTCATTGTGGTTATTGGACTAAGGCTGCCAATGGGT
AAACGGAACGCAAAGTTTCAGGGATAGAAAGCTAGTAAGGATTAGTCCGTAATTTTTGAGAAACTGTAGCATGCATTTGATACTGGGCAAGTCTATTGTTGTCATGCCAATCAAAAATAA
ACCAAACGCTATCACAACAGCTTGATGGAATTGCACTAGTGATGGCATTCGCTTCATTGCCTCAAAGACGTCCAGTCAGCGCATTCTATCAGCCAGGTGAAGTACGAATATATTCTAGGT
TAAGCTCAGTGACAGGGCAAAGACGAGGAAAAATGGTGTTTTAGGAACTTGAACAGCGTGTTATAATGGGTATCTTAGCATCACGCAATGAAGCTACACAGCGTAGATACAAAACAGAAA
AAAGGTGTCTGTCTGTAATTTTGATATCAGTGATTTTGTTTCATCCTGAAATGCTACACCACGACAAATTAAATAGATTTTACCCTGGTGGTAGACCCTATGGACTGGTTGTAATACTTA
CAGTAGCTGGTTGGACTTATGACATAACGTTACAATAAATGGTGGAGCCATTGGCCTGAAGCTTTATGTAATCGAGAGTAATGATTAGCGAGGCATCAAAAGTGTCTAGATGGATCTCAA
TTAGATAACTTTCGATATCATTGATGCCTTGCTGGATATTATATTAGTTTAGATGTATTTCGATGTCTCTGACGCCGCTCCTTCATATCAGCAAGGCTCCATCTTGCCGACCTTTGGAAT
GCGATATCTACGTGGACAGCGAGCTGTAAAGGGAGGCTGAAGTTATACTGCTGTAAAGTAATTGCATTTTCAGCAGGATCACAGAATTTAATTCCCCATATCAATTGCCACTATAATATC
AATAAGGCGTGCTTGACTGGGGAATGTAAGATCAAAATCAGCAGCCTGTAAATGGGTGTTTTCCTGCGTCGACCGCATACAGTCATATAATCGTAAGGTCACTGTATTGTTATATGTTTT
GCGTCTGGTACTTGACGCTTATTACTACTAATGTGAAATATATTTTTTAGGTCTCACACCTATCGCAACTTTACTTTAGAAATTAGTAAATTTAGTAAATTCCAAGTCAAAATGTTTTTG
CAACTGTATCGAACGATCATTTCCAAACGATACCGACCGTTATATAAAGTGGCCTAATTGGTTTAAACTGAACCAATACAGTCGATCAGATTGCGATTCTATTTTCTGGAATTTTATCGC
CCTTTCCGAGAAGATCACAACTCGATTCAATTAAAAATGGTGGCTTCTGTGAGTGATGCGTTACAAGGAACGATATTTGAACGCGAACGTGCTTTTATTGAGCTTCCTGCGAATGTGCAG
GAGGAAGCTAAATCCCTCTTCGCTTACTTTATCAGCTCGGAAGGAAAAACTGAGTTGACCAAACATTGTGGTAGCAAAAAGTGCAAAACTGGCTCCTTCCAAACAATCAAAGGCTCTGCG
TTTTTGAGCCTTGTTGAGGCAAGCCTCAAGCGAGGAGATGATACTGAACCAAAGAGTGAAACAAGTGCTGCTCTGTCCCCGACTCCAGAAGAGATCAAACAGCTCGCATACGCCCTCGTA
TTTTGCGGCTTACTGACACCTTACAAAGAAAATGAGTCACCGATTGGACCGTTCTCATTTGATACTGAATTATACGTTGTCGTAATCTCTCTGTCCGCAGAAAATGAGGAAGGGATGTCG
GTTTGGAGAGTGAAAGAGGGAGCAATTCAAGCTGGATTTTTGAAGCGCAAAGGCAGTGGGATTTTTTCCAATCTCAGAGGAAGTAAGAAAGCGTATGTGATTGTCAATGAAACACAAAAG
CTGTTGGGTATTTTCGAATCCGACCATGCCCTCAAAACTCAGTCAGTGATACAATTCACTGCGGAAAGTTGGGTCGAATTCGATTCCAATATCGCGAACGCTATCAAAGTTCACAACAAA
GATGATTCTGAGGTTCTGATTGCGTCCAGCAAAGAAAAAGCCGAAGAGTGGCTGAATGCGTGCATCAACGCGGGTGCTCAGTATCGAGAAGCATTCACGAAAAATATTGATGAGGTCACT
TCATTTTATGAATTGAGTGACTTTGATATGGAGCACAAAGAAATTTCGATGAGCAACTACAAGGGCAAAGTCTTGCTCATTGTGAATGTGTCTAGCATGTGTGGCTTGACACCCGCGAAT
TATACTGATCTGGTGGCCCTGGACGAAAAGTACCGTGATCAAGGTTTACAAGTTTTGGCATTCCCGTGCAATCAATTTGCCAACCAGGAACCTGGAACGCACGAAGAAATCATGGAGTTT
GTCAAGCAGTACAAGTGCACCTTTCCATTTTTCGAAAAAGCTGACGTAAACGGCGCTAAAGCACGACCCGTTTTCATGTATCTCAAGGCGAAGCTTCCAGGCTCTTTTGGAAATTTTGTC
AAGTGGAACTTTACCAAATTCCTTGTCGATCGCGATGGAAAACCGCACAAAAGATACGCACCAAAGGACCCGCCTCTCTCCTTTGAAGATGAGATCAAGACATTACTAGCAGCAGAAACG
GAAAAAGTGGAAAAAGCGAGCACAACCGCGGACGAGACCGTTGTGGACTCTAACAAAGAAGCCAAGACGGCTGAAAAACCAGACACGACGGAGGACACTCAAGTCAACACAGCGGGAGAC
GAAGCAAAGCAGGAGGAATCCACCGA
GTCACCCGCTCTCAATGAGTCAGAAGCACAAGTTGACGCGCAAGTGAAGAAGGAGGAGGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTTACATGATCAGCCTTCATTCTCGGAAAGAGATCCCTATTCTTGCGCACTGACCACAGTCACGGCAGCACAGATTTTTCAGAGGCTCAGATTGCGATTCTATTTTCTGGAATTT
TATCGCCCTTTCCGAGAAGATCACAACTCGATTCAATTAAAAATGGTGGCTTCTGTGAGTGATGCGTTACAAGGAACGATATTTGAACGCGAACGTGCTTTTATTGAGCTTCCTGCGAAT
GTGCAGGAGGAAGCTAAATCCCTCTTCGCTTACTTTATCAGCTCGGAAGGAAAAACTGAGTTGACCAAACATTGTGGTAGCAAAAAGTGCAAAACTGGCTCCTTCCAAACAATCAAAGGC
TCTGCGTTTTTGAGCCTTGTTGAGGCAAGCCTCAAGCGAGGAGATGATACTGAACCAAAGAGTGAAACAAGTGCTGCTCTGTCCCCGACTCCAGAAGAGATCAAACAGCTCGCATACGCC
CTCGTATTTTGCGGCTTACTGACACCTTACAAAGAAAATGAGTCACCGATTGGACCGTTCTCATTTGATACTGAATTATACGTTGTCGTAATCTCTCTGTCCGCAGAAAATGAGGAAGGG
ATGTCGGTTTGGAGAGTGAAAGAGGGAGCAATTCAAGCTGGATTTTTGAAGCGCAAAGGCAGTGGGATTTTTTCCAATCTCAGAGGAAGTAAGAAAGCGTATGTGATTGTCAATGAAACA
CAAAAGCTGTTGGGTATTTTCGAATCCGACCATGCCCTCAAAACTCAGTCAGTGATACAATTCACTGCGGAAAGTTGGGTCGAATTCGATTCCAATATCGCGAACGCTATCAAAGTTCAC
AACAAAGATGATTCTGAGGTTCTGATTGCGTCCAGCAAAGAAAAAGCCGAAGAGTGGCTGAATGCGTGCATCAACGCGGGTGCTCAGTATCGAGAAGCATTCACGAAAAATATTGATGAG
GTCACTTCATTTTATGAATTGAGTGACTTTGATATGGAGCACAAAGAAATTTCGATGAGCAACTACAAGGGCAAAGTCTTGCTCATTGTGAATGTGTCTAGCATGTGTGGCTTGACACCC
GCGAATTATACTGATCTGGTGGCCCTGGACGAAAAGTACCGTGATCAAGGTTTACAAGTTTTGGCATTCCCGTGCAATCAATTTGCCAACCAGGAACCTGGAACGCACGAAGAAATCATG
GAGTTTGTCAAGCAGTACAAGTGCACCTTTCCATTTTTCGAAAAAGCTGACGTAAACGGCGCTAAAGCACGACCCGTTTTCATGTATCTCAAGGCGAAGCTTCCAGGCTCTTTTGGAAAT
TTTGTCAAGTGGAACTTTACCAAATTCCTTGTCGATCGCGATGGAAAACCGCACAAAAGATACGCACCAAAGGACCCGCCTCTCTCCTTTGAAGATGAGATCAAGACATTACTAGCAGCA
GAAACGGAAAAAGTGGAAAAAGCGAGCACAACCGCGGACGAGACCGTTGTGGACTCTAACAAAGAAGCCAAGACGGCTGAAAAACCAGACACGACGGAGGACACTCAAGTCAACACAGCG
GGAGACGAAGCAAAGCAGGAGGAATCCACCGA
TGAAGAAGGAGGAGGCTGA

Retrieve as FASTA