Entry information : AthiAPx-CcP01
Entry ID 11649
Creation 2013-02-27 (Christophe Dunand)
Last sequence changes 2013-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: AthiAPx-CcP01
Name AthiAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Amanitaceae Amanita
Organism Amanita thiersii    [TaxId: 235537 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AthiAPx-CcP01
start..stop
S start..stop
AmusAPx-CcP01 719 0 8..598 13..598
LbiAPx-CcP 689 0 3..581 2..571
AbAPx-CcP01_bisporus 678 0 22..572 23..575
LameAPx-CcP01 671 0 3..581 2..563
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 236096..236308 213 N° 2 236376..236462 87 N° 3 236525..236591 67 N° 4 236668..236989 322
N° 5 237047..237160 114 N° 6 237212..237386 175 N° 7 237441..237875 435 N° 8 237931..238332 402
join(236096..236308,236376..236462,236525..236591,236668..236989,237047..237160, 237212..237386,237441..237875,237931..238332)


exon

Literature and cross-references AthiAPx-CcP01
DNA ref. JGI genome:   scaffold_17 (236096..238332)
Cluster/Prediction ref. JGI gene:   58608
Protein sequence: AthiAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   605 (583)
PWM (Da):   %s   65900.84 (63478.6)  
PI (pH):   %s   6.07 (5.33) Peptide Signal:   %s   cut: 22 range:22-604
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRHAQFALLFASSITPHALSYKWPSPQYEALEGYLYEGRRSDGSNLAAIVHPCRKRQGTLSSIPAEWLRFAFHDMSTYDASNGTGGLDSSITYELNRPENFGLGFVNTQSDFENFPNKYVSRSDVIALGAIMAVATCGGPTIPFRGGRVDALTAGVFGTPEPQQDLQTHTQMFSRAGFSQTEMIQMVACGHTLGGVRSADKPEIVPPGPDPTVTTIVDFDTTMQFDNKVVTEYLSGTTHNPLVVTPNVTLQSDSRIFSSDNNSTMQSLSSSDTFASTCKSIFERMLNTVPSGVRLTDEIQLIPAKVHDIQLTVERNNLVLKTSLRLTQPIDGPVNTKRTVTMFFCDRYGSKANCNGGSKSAQPARTVKEDPNLSPVTFNLGKYFINYNFVVPIDPTTSISKFWFEVDEKDGSKPTVYDNERDDYVVDQDQLIFVPTLGSTDYRLNPTRRGGGPVGGSNQTFTRTYTLVAGVRQESNPSTVTMSVFDSAIRGYPAPLNQTIPLTLNSSLSPAGGYKFYSARVESVGLQLTADFVAVVDGKQYGLDFQSTTFLDNTPYVPTTNVTNTSNTPTTNHSAALRPSPTGATLLVIAFASIVRLALDIFS

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGACGACATGCCCAGTTTGCGCTTCTTTTTGCATCCTCGATCACTCCGCATGCTCTGAGTTATAAATGGCCGTCACCTCAATACGAAGCATTGGAGGGCTACTTGTATGAAGGCAGA
CGGTCCGATGGCTCTAATTTGGCGGCTATTGTCCACCCGTGCCGGAAGCGACAAGGCACCTTGTCATCTATTCCTGCGGAATGGCTCCGTTTT
GTACGATCCCTGTTCTTCTGTCGTATC
ACCTTGAGTGATCCTCATTGAAGCATGATCTCGTCTACAGGCTTTTCATGACATGTCTACTTATGATGCAAGTAATGGTACAGGAGGACTTGATTCGTCAATCACATACGAACTAAACAG
GCCGGAG
GTGTGTGTTTCCCTTCTGTATGTCCCAACACATGTTTCTCATCATGTCTTTCCTATGCCCAGAACTTTGGTCTAGGATTCGTCAATACCCAGTCTGACTTTGAAAACTTTCCC
AACAAATACGTTTCAC
GTATGTCTTGCTCACCCTTTACCCTCCAAAGACGTGCCTCACGCGCTTTTGTCTCCTTTTGAATGAATGTGATTAGGATCCGACGTCATTGCTCTCGGGGCGAT
CATGGCAGTTGCGACCTGTGGGGGCCCAACCATACCCTTTCGTGGCGGACGCGTGGATGCGCTGACGGCAGGCGTGTTTGGCACACCGGAACCGCAACAAGATCTGCAGACGCATACGCA
GATGTTCAGCCGAGCAGGGTTTTCCCAAACCGAGATGATTCAAATGGTTGCTTGCGGTCACACTTTGGGTGGTGTCCGCTCTGCGGACAAGCCTGAAATTGTGCCCCCCGGCCCCGATCC
GACGGTGACGACTATCGTGGACTTTGATACCACTATGCAGTTTGATAATAAAGT
GTGAGCGTTTTATTGTTTCACACTCGGTTGTGGGTTGCTCATTCAGGTCGGATATAGCGTGACAGA
GTATCTATCTGGAACTACGCATAATCCTCTTGTTGTTACTCCAAATGTAACGCTTCAATCTGATAGTCGGATATTCTCCAGCGACAACAATAGTACGATGCAAAG
GTACAATGAGCTGCA
CCTTTATACTTCTAAATCCTCTAATATAATCGCTAGTCTTTCTTCGTCAGATACATTCGCCTCGACCTGCAAAAGTATTTTTGAACGGATGCTGAATACCGTTCCAAGTGGTGTACGACT
GACAGACGAGATTCAACTAATACCCGCCAAAGTTCATGATATACAATTAACAGTTGAACGGAATAATCTTGTCCTCAAGACATCTCTTAGG
GTATGAATTTCTTCCCTTCTCTTCAACTA
TCCCTCACAACAGTCTCTCTTCTAGCTCACTCAACCGATCGACGGCCCTGTAAACACTAAGAGGACGGTTACAATGTTCTTCTGTGACCGCTATGGAAGCAAAGCAAACTGCAATGGCGG
GTCCAAATCGGCGCAACCTGCTCGAACTGTCAAGGAGGACCCGAATCTATCCCCAGTTACCTTTAATCTCGGGAAATACTTTATTAATTATAACTTTGTTGTCCCGATCGATCCTACCAC
ATCAATATCCAAGTTCTGGTTCGAGGTGGATGAGAAGGACGGATCGAAACCGACGGTGTATGATAATGAAAGGGACGACTACGTGGTTGACCAAGATCAGTTGATTTTTGTGCCTACACT
GGGATCGACAGATTACAGACTGAACCCGACTCGAAGAGGTGGAGGCCCTGTTGGCGGCTCGAACCAAACGTTCACAAGGACGTATACGTTAGTTGCCGGA
GTATGTCCTTTTCTCTGGAG
GTGTGTAGTATCAGCGACTGATGACTTTTGTGTAGGTTAGACAGGAATCCAATCCCTCAACTGTGACCATGTCTGTGTTTGATTCGGCGATCCGTGGCTACCCTGCACCGTTGAACCAGA
CTATACCGCTCACACTCAACAGCTCGCTATCTCCCGCTGGAGGCTACAAATTCTATTCTGCTAGGGTGGAGTCAGTTGGTCTGCAGCTAACTGCCGACTTTGTGGCGGTAGTGGATGGGA
AGCAGTATGGATTGGACTTCCAGTCCACGACGTTTCTGGACAACACACCCTATGTGCCGACGACGAATGTGACTAACACAAGTAATACGCCAACGACAAACCATAGTGCGGCCTTGCGGC
CATCCCCGACTGGTGCAACGCTGCTGGTGATCGCATTTGCAAGCATCGTTCGTCTGGCGCTGGACATATTTTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGACGACATGCCCAGTTTGCGCTTCTTTTTGCATCCTCGATCACTCCGCATGCTCTGAGTTATAAATGGCCGTCACCTCAATACGAAGCATTGGAGGGCTACTTGTATGAAGGCAGA
CGGTCCGATGGCTCTAATTTGGCGGCTATTGTCCACCCGTGCCGGAAGCGACAAGGCACCTTGTCATCTATTCCTGCGGAATGGCTCCGTTTT
GCTTTTCATGACATGTCTACTTATGAT
GCAAGTAATGGTACAGGAGGACTTGATTCGTCAATCACATACGAACTAAACAGGCCGGAG
AACTTTGGTCTAGGATTCGTCAATACCCAGTCTGACTTTGAAAACTTTCCCAACAAATAC
GTTTCAC
GATCCGACGTCATTGCTCTCGGGGCGATCATGGCAGTTGCGACCTGTGGGGGCCCAACCATACCCTTTCGTGGCGGACGCGTGGATGCGCTGACGGCAGGCGTGTTTGGCACA
CCGGAACCGCAACAAGATCTGCAGACGCATACGCAGATGTTCAGCCGAGCAGGGTTTTCCCAAACCGAGATGATTCAAATGGTTGCTTGCGGTCACACTTTGGGTGGTGTCCGCTCTGCG
GACAAGCCTGAAATTGTGCCCCCCGGCCCCGATCCGACGGTGACGACTATCGTGGACTTTGATACCACTATGCAGTTTGATAATAAAGT
CGTGACAGAGTATCTATCTGGAACTACGCAT
AATCCTCTTGTTGTTACTCCAAATGTAACGCTTCAATCTGATAGTCGGATATTCTCCAGCGACAACAATAGTACGATGCAAAG
TCTTTCTTCGTCAGATACATTCGCCTCGACCTGCAAA
AGTATTTTTGAACGGATGCTGAATACCGTTCCAAGTGGTGTACGACTGACAGACGAGATTCAACTAATACCCGCCAAAGTTCATGATATACAATTAACAGTTGAACGGAATAATCTTGTC
CTCAAGACATCTCTTAGG
CTCACTCAACCGATCGACGGCCCTGTAAACACTAAGAGGACGGTTACAATGTTCTTCTGTGACCGCTATGGAAGCAAAGCAAACTGCAATGGCGGGTCCAAA
TCGGCGCAACCTGCTCGAACTGTCAAGGAGGACCCGAATCTATCCCCAGTTACCTTTAATCTCGGGAAATACTTTATTAATTATAACTTTGTTGTCCCGATCGATCCTACCACATCAATA
TCCAAGTTCTGGTTCGAGGTGGATGAGAAGGACGGATCGAAACCGACGGTGTATGATAATGAAAGGGACGACTACGTGGTTGACCAAGATCAGTTGATTTTTGTGCCTACACTGGGATCG
ACAGATTACAGACTGAACCCGACTCGAAGAGGTGGAGGCCCTGTTGGCGGCTCGAACCAAACGTTCACAAGGACGTATACGTTAGTTGCCGGA
GTTAGACAGGAATCCAATCCCTCAACT
GTGACCATGTCTGTGTTTGATTCGGCGATCCGTGGCTACCCTGCACCGTTGAACCAGACTATACCGCTCACACTCAACAGCTCGCTATCTCCCGCTGGAGGCTACAAATTCTATTCTGCT
AGGGTGGAGTCAGTTGGTCTGCAGCTAACTGCCGACTTTGTGGCGGTAGTGGATGGGAAGCAGTATGGATTGGACTTCCAGTCCACGACGTTTCTGGACAACACACCCTATGTGCCGACG
ACGAATGTGACTAACACAAGTAATACGCCAACGACAAACCATAGTGCGGCCTTGCGGCCATCCCCGACTGGTGCAACGCTGCTGGTGATCGCATTTGCAAGCATCGTTCGTCTGGCGCTG
GACATATTTTCATAA

Retrieve as FASTA