Entry information : AthiAPx-CcP02
Entry ID 11650
Creation 2013-02-27 (Christophe Dunand)
Last sequence changes 2013-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: AthiAPx-CcP02
Name AthiAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Amanitaceae Amanita
Organism Amanita thiersii    [TaxId: 235537 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AthiAPx-CcP02
start..stop
S start..stop
AthiAPx-CcP03 974 0 1..504 1..504
AthiAPx-CcP05 723 0 1..504 1..501
AthiAPx-CcP04 702 0 1..504 1..503
CuniAPx-CcP01 369 3e-123 5..500 6..512
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1592..1795 204 N° 2 1406..1533 128 N° 3 1109..1353 245 N° 4 520..1055 536
N° 5 277..465 189 N° 6 3..212 210  
complement(join(3..212,277..465,520..1055,1109..1353,1406..1533,1592..1795))


exon

Literature and cross-references AthiAPx-CcP02
DNA ref. JGI genome:   scaffold_333 (1795..3)
Cluster/Prediction ref. JGI gene:   43976
Protein sequence: AthiAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   504 (485)
PWM (Da):   %s   55380.44 (53456.4)  
PI (pH):   %s   6.72 (6.51) Peptide Signal:   %s   cut: 20 range:20-504
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKQGRALLLSLGLAQSSLGVYVWPAKTDGLEEVIFNDHGFGDAGIGNHIQQCADQGRGGPGAQIAATWLRSCWHDMATHRIAEKAGGVDASITFETDRMENIGIGFNNTFLDLYPAYNSRVPFSDLLASAVYFALRKCGGPALNVRAGRIDAHEEGPFGVPDPNEAFHVHVNKFARAGRNQTEMIMMIACGTIGGVHGSDFPTITGNPAQPFTAHFDSTFNHYDSHIAIDFINDNTTNPLASGPLMTRSDARVFSSDNNATITRMANLDEFRSICFDTFNRMIDTVPANVELSDPITPTWIRPFKPQLSVNPDGSIKFDGQIRIHTTDIPDGDNLKVNLLYADRNGKIGRKNLLQTKYLARGFGIDFHFYYDINATIPNGISSFNIEVTDSNNKRTVHDNAGHGFPMSDRVVFQQAESCFDPATKTVTVIGAVSNKIRNPQVTMSVFDRRPQQSSLIPRLVKDNVRMRRVTGNAPKGYTLFRGQYTYTLEEGGEFSIIANAR

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGGGTCGCGCTCTCCTCCTCTCTTTGGGTCTTGCCCAGTCCTCTCTTGGTGTCTATGTTTGGCCCGCCAAGACGGACGGTCTTGAGGAAGTCATCTTCAACGACCACGGCTTC
GGTGATGCTGGAATTGGCAACCACATTCAGCAGTGCGCTGACCAAGGTCGTGGTGGTCCCGGTGCACAGATCGCTGCTACTTGG
GTAAGTAGCTATTTTCATTCTAATCTACCTTTTTCT
GAAGTGAGATGAATTTCTCTAGCTCCGGTCCTGCTGGCACGATATGGCTACCCACCGTATTGCTGAGAAGGCTGGTGGTGTCGATGCCTCGATCACATTCGAGACCGACCGCATGGAGAA
CATTGGTATTGGTTTCAACAACACCTTCTT
GTATGACTTTTCAATTCCTATCATATGCGGCTTATTCATCAACTATTCACAGGGACTTGTATCCGGCATACAACTCCCGTGTGCCATTCT
CCGATCTCCTTGCTTCGGCCGTGTACTTCGCCCTCCGCAAGTGTGGTGGCCCCGCTCTCAATGTTCGTGCTGGCCGTATTGATGCCCACGAAGAAGGCCCATTCGGTGTCCCTGACCCGA
ACGAGGCCTTCCACGTCCACGTTAACAAGTTCGCTCGTGCTGGTCGCAACCAGACCGAGATGATCATGATGATTGCCTGTGGTCACA
GTAAGTACAAGATTATAACGAACATGAGAATCC
ACGCTAAGCGTCTTACCCAGCCATTGGTGGTGTCCACGGAAGTGACTTCCCGACCATCACTGGCAACCCAGCTCAGCCATTCACGGCTCACTTCGACTCTACCTTCAACCACTACGATAG
CCACATCGCCATTGATTTCATCAATGACAACACCACCAACCCGTTGGCATCTGGTCCGTTGATGACCCGCTCTGATGCTCGCGTTTTCTCTTCCGACAACAATGCGACCATCACCCGCAT
GGCCAACCTCGATGAGTTCCGCAGCATTTGCTTCGACACATTCAACAGGATGATTGACACCGTCCCTGCTAATGTTGAGCTCTCCGATCCCATTACTCCAACCTGGATCAGGCCATTCAA
GCCTCAATTGTCGGTCAACCCAGATGGTTCCATCAAATTCGACGGCCAGATCCGTATTCACACCACTGATATCCCAGATGGTGACAACCTCAAGGTCAACCTTTTGTACGCCGACCGCAA
TGGAAAGATTGGCAGGAAGAACCTCCTCCAAACCAAGTACCTCGCTCGTGGTTTCGGTATTGACTTCCACTTCGAC
GTATGTCTTTGTTCATATGCTGAGGTCGAATGGCAGCTGACATA
GATGATGCAGTACTATGACATCAATGCTACCATCCCCAACGGTATCTCGAGCTTCAACATTGAGGTTACTGACTCGAACAACAAGAGGACCGTCCACGACAATGCCGGCCATGGATTCCC
GATGTCCGACCGCGTTGTCTTCCAACAGGCCGAATCTTGCTTCGACCCTGCCACCAAGACTGTCACCGTCATCGGCGCC
GTACGTCTCACTTTCCCTTGTTCGTCGATGATTCTAGTTAT
TGATAAAGGATGGGCGATAACAGGTTAGCAACAAGATCAGGAACCCTCAGGTCACCATGTCCGTCTTCGACAGGAGGCCTCAACAGAGTAGCTTGATCCCGAGGTTGGTCAAGGACAACG
TCAGGATGAGGAGAGTTACCGGTAATGCACCAAAGGGCTACACCCTCTTCCGCGGCCAATACACATACACTCTTGAGGAGGGTGGTGAATTCAGCATTATTGCCAACGCCCGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGGGTCGCGCTCTCCTCCTCTCTTTGGGTCTTGCCCAGTCCTCTCTTGGTGTCTATGTTTGGCCCGCCAAGACGGACGGTCTTGAGGAAGTCATCTTCAACGACCACGGCTTC
GGTGATGCTGGAATTGGCAACCACATTCAGCAGTGCGCTGACCAAGGTCGTGGTGGTCCCGGTGCACAGATCGCTGCTACTTGG
CTCCGGTCCTGCTGGCACGATATGGCTACCCACCGT
ATTGCTGAGAAGGCTGGTGGTGTCGATGCCTCGATCACATTCGAGACCGACCGCATGGAGAACATTGGTATTGGTTTCAACAACACCTTCTT
GGACTTGTATCCGGCATACAACTCCCGT
GTGCCATTCTCCGATCTCCTTGCTTCGGCCGTGTACTTCGCCCTCCGCAAGTGTGGTGGCCCCGCTCTCAATGTTCGTGCTGGCCGTATTGATGCCCACGAAGAAGGCCCATTCGGTGTC
CCTGACCCGAACGAGGCCTTCCACGTCCACGTTAACAAGTTCGCTCGTGCTGGTCGCAACCAGACCGAGATGATCATGATGATTGCCTGTGGTCACA
CCATTGGTGGTGTCCACGGAAGT
GACTTCCCGACCATCACTGGCAACCCAGCTCAGCCATTCACGGCTCACTTCGACTCTACCTTCAACCACTACGATAGCCACATCGCCATTGATTTCATCAATGACAACACCACCAACCCG
TTGGCATCTGGTCCGTTGATGACCCGCTCTGATGCTCGCGTTTTCTCTTCCGACAACAATGCGACCATCACCCGCATGGCCAACCTCGATGAGTTCCGCAGCATTTGCTTCGACACATTC
AACAGGATGATTGACACCGTCCCTGCTAATGTTGAGCTCTCCGATCCCATTACTCCAACCTGGATCAGGCCATTCAAGCCTCAATTGTCGGTCAACCCAGATGGTTCCATCAAATTCGAC
GGCCAGATCCGTATTCACACCACTGATATCCCAGATGGTGACAACCTCAAGGTCAACCTTTTGTACGCCGACCGCAATGGAAAGATTGGCAGGAAGAACCTCCTCCAAACCAAGTACCTC
GCTCGTGGTTTCGGTATTGACTTCCACTTCGAC
TACTATGACATCAATGCTACCATCCCCAACGGTATCTCGAGCTTCAACATTGAGGTTACTGACTCGAACAACAAGAGGACCGTCCAC
GACAATGCCGGCCATGGATTCCCGATGTCCGACCGCGTTGTCTTCCAACAGGCCGAATCTTGCTTCGACCCTGCCACCAAGACTGTCACCGTCATCGGCGCC
GTTAGCAACAAGATCAGG
AACCCTCAGGTCACCATGTCCGTCTTCGACAGGAGGCCTCAACAGAGTAGCTTGATCCCGAGGTTGGTCAAGGACAACGTCAGGATGAGGAGAGTTACCGGTAATGCACCAAAGGGCTAC
ACCCTCTTCCGCGGCCAATACACATACACTCTTGAGGAGGGTGGTGAATTCAGCATTATTGCCAACGCCCGC

Retrieve as FASTA