Entry information : AthiAPx-CcP03
Entry ID 11651
Creation 2013-02-27 (Christophe Dunand)
Last sequence changes 2013-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: AthiAPx-CcP03
Name AthiAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Amanitaceae Amanita
Organism Amanita thiersii    [TaxId: 235537 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AthiAPx-CcP03
start..stop
S start..stop
AthiAPx-CcP02 974 0 1..504 1..504
AthiAPx-CcP05 744 0 1..526 1..525
AthiAPx-CcP04 715 0 1..526 1..529
CuniAPx-CcP01 384 1e-128 6..525 7..531
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35909..36112 204 N° 2 36171..36298 128 N° 3 36352..36596 245 N° 4 36650..37185 536
N° 5 37238..37426 189 N° 6 37490..37759 270 N° 7 37819..37827 9  
join(35909..36112,36171..36298,36352..36596,36650..37185,37238..37426,37490..377 59,37819..37827)


exon

Literature and cross-references AthiAPx-CcP03
DNA ref. JGI genome:   scaffold_90 (35909..37827)
Cluster/Prediction ref. JGI gene:   65091
Protein sequence: AthiAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   527 (507)
PWM (Da):   %s   57881.59 (55828.5)  
PI (pH):   %s   6.6 (6.46) Peptide Signal:   %s   cut: 20 range:20-526
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKQGHAFLLSLGLAQSSLGAYVWPAKTDGLEEVIFNDHGFGDAGIGNHIQQCADQGRGGPGAQIAATWLRSCWHDMATHRIAEKAGGVDASITFETDRMENIGIGFNNTFLDLLPAYSSRVPFADLLASAVYFAVRKCGGPALNVRAGRIDAHEEGPFGVPDPNEAFHVHLNKFARAGRNQTEMIMMIACGTIGGVHGSDFPTITGNPAQPFTAHFDSTFNHYDSHIAIDFINDNTTNPLASGPLMTRSDARVFSSDNNATITRMANLEEFRNICFDTFNRMIDTVPSFVELSDPITPTPIRPFKPQLSVNPDGSIKFDGQIRIHTTDIPDGDNLKVNLLYADTNGRINKKNVIHTKYLARGFGIDFHFYYDINANIPNGISSFNIEVTDSNNKKTVHDNAGHGFQISDRVVFQKAQSCFDPTTRTVTVYGAISNKIKNPQVTLSVFDRQRQQSSLIPKLVKDNVKMRRVNETAPKGYTLFRGQYTYSLEEGGEFSIIASARNGETFSDEFKMTSLLNGTNCAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAAGGTCATGCTTTCCTCCTCTCTTTGGGCCTCGCCCAGTCCTCTCTTGGTGCTTACGTCTGGCCCGCCAAAACGGACGGTCTTGAGGAAGTCATCTTTAACGACCATGGCTTC
GGTGATGCCGGAATTGGCAACCACATCCAGCAGTGCGCTGACCAAGGTCGTGGTGGCCCTGGTGCACAGATCGCTGCTACTTGG
GTAAGTGTCTGACACCAGCTGGTGCAAACTCTTCCT
AATCTGACATGAATTCTTCTAGCTCCGGTCCTGCTGGCACGATATGGCCACTCACCGTATAGCCGAAAAGGCTGGTGGTGTCGATGCCTCGATCACATTCGAGACCGACCGCATGGAGAA
CATTGGTATTGGTTTCAATAACACCTTCTT
GTATGACTTTCCACTTCTTCTCTTGGTACAGCTCGTTCATCAGCCATTTACAGGGACTTGCTTCCGGCATACAGCTCCCGTGTGCCATTC
GCCGATCTCCTTGCTTCGGCCGTGTACTTCGCTGTCCGCAAGTGTGGTGGCCCCGCTCTCAATGTTCGTGCTGGCCGTATCGATGCCCACGAAGAGGGCCCATTCGGTGTCCCTGACCCG
AACGAGGCCTTCCACGTCCACCTTAACAAGTTCGCTCGTGCTGGTCGCAACCAGACCGAGATGATCATGATGATTGCCTGTGGTCACA
GTAAGTACAAGATTATAACGAACATGAGAATC
CACGCTAAGCGTCTTACCCAGCCATTGGTGGTGTCCACGGAAGCGACTTCCCGACCATCACTGGCAACCCAGCTCAGCCATTCACGGCTCACTTCGACTCTACCTTCAACCACTACGATA
GCCACATTGCCATTGACTTCATCAATGACAACACTACCAACCCGTTGGCATCTGGTCCGTTGATGACCCGCTCTGATGCTCGCGTTTTCTCTTCCGACAACAATGCGACCATTACCCGCA
TGGCCAACCTCGAGGAGTTCCGCAACATCTGCTTCGACACGTTCAACAGGATGATTGACACCGTCCCCTCTTTTGTTGAGCTCTCCGATCCTATTACTCCAACTCCGATCAGGCCATTCA
AGCCTCAATTGTCGGTCAACCCAGATGGTTCCATCAAATTCGATGGCCAGATCCGTATCCACACCACTGACATCCCCGACGGTGACAACCTCAAGGTTAACTTGTTGTACGCAGACACCA
ATGGAAGGATCAACAAGAAGAACGTCATCCATACCAAGTACCTTGCTCGTGGCTTCGGTATCGACTTCCACTTCGAT
GTAGGTGCTTTCGTACCACTGGTTTGAGTGATGACTGACATAG
ATTATGTAGTACTATGACATCAACGCCAACATCCCCAACGGTATCTCGAGCTTCAACATTGAGGTCACCGACTCGAACAATAAGAAGACCGTCCATGACAATGCTGGCCACGGATTCCAG
ATCTCCGATCGTGTTGTCTTCCAGAAGGCTCAATCCTGCTTCGACCCCACCACCAGGACTGTCACCGTCTACGGCGCC
GTATGTCTTTCATTTTTCTGCTCGTTCGCGCTTGTTTACTGA
CTGGGGATATGCGGGTAACAGATCAGCAACAAGATCAAGAACCCTCAGGTTACATTGTCCGTCTTTGACAGGCAACGCCAGCAGAGCAGCTTGATTCCCAAGCTTGTCAAGGACAACGTC
AAGATGAGGAGGGTCAACGAGACTGCACCCAAGGGCTACACTCTCTTCCGCGGCCAATACACATACTCTCTTGAGGAGGGTGGTGAATTCAGCATCATTGCCAGCGCCCGCAATGGCGAG
ACATTCTCTGATGAATTCAAGATGACTTCCCTTCTCAACGGCACCAACTGC
GTACGTTGATCTTTTGGGTTTTTCCTTGGTGATTCGCTAACGACTTGCTTCTACAACAGGCAAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAAGGTCATGCTTTCCTCCTCTCTTTGGGCCTCGCCCAGTCCTCTCTTGGTGCTTACGTCTGGCCCGCCAAAACGGACGGTCTTGAGGAAGTCATCTTTAACGACCATGGCTTC
GGTGATGCCGGAATTGGCAACCACATCCAGCAGTGCGCTGACCAAGGTCGTGGTGGCCCTGGTGCACAGATCGCTGCTACTTGG
CTCCGGTCCTGCTGGCACGATATGGCCACTCACCGT
ATAGCCGAAAAGGCTGGTGGTGTCGATGCCTCGATCACATTCGAGACCGACCGCATGGAGAACATTGGTATTGGTTTCAATAACACCTTCTT
GGACTTGCTTCCGGCATACAGCTCCCGT
GTGCCATTCGCCGATCTCCTTGCTTCGGCCGTGTACTTCGCTGTCCGCAAGTGTGGTGGCCCCGCTCTCAATGTTCGTGCTGGCCGTATCGATGCCCACGAAGAGGGCCCATTCGGTGTC
CCTGACCCGAACGAGGCCTTCCACGTCCACCTTAACAAGTTCGCTCGTGCTGGTCGCAACCAGACCGAGATGATCATGATGATTGCCTGTGGTCACA
CCATTGGTGGTGTCCACGGAAGC
GACTTCCCGACCATCACTGGCAACCCAGCTCAGCCATTCACGGCTCACTTCGACTCTACCTTCAACCACTACGATAGCCACATTGCCATTGACTTCATCAATGACAACACTACCAACCCG
TTGGCATCTGGTCCGTTGATGACCCGCTCTGATGCTCGCGTTTTCTCTTCCGACAACAATGCGACCATTACCCGCATGGCCAACCTCGAGGAGTTCCGCAACATCTGCTTCGACACGTTC
AACAGGATGATTGACACCGTCCCCTCTTTTGTTGAGCTCTCCGATCCTATTACTCCAACTCCGATCAGGCCATTCAAGCCTCAATTGTCGGTCAACCCAGATGGTTCCATCAAATTCGAT
GGCCAGATCCGTATCCACACCACTGACATCCCCGACGGTGACAACCTCAAGGTTAACTTGTTGTACGCAGACACCAATGGAAGGATCAACAAGAAGAACGTCATCCATACCAAGTACCTT
GCTCGTGGCTTCGGTATCGACTTCCACTTCGAT
TACTATGACATCAACGCCAACATCCCCAACGGTATCTCGAGCTTCAACATTGAGGTCACCGACTCGAACAATAAGAAGACCGTCCAT
GACAATGCTGGCCACGGATTCCAGATCTCCGATCGTGTTGTCTTCCAGAAGGCTCAATCCTGCTTCGACCCCACCACCAGGACTGTCACCGTCTACGGCGCC
ATCAGCAACAAGATCAAG
AACCCTCAGGTTACATTGTCCGTCTTTGACAGGCAACGCCAGCAGAGCAGCTTGATTCCCAAGCTTGTCAAGGACAACGTCAAGATGAGGAGGGTCAACGAGACTGCACCCAAGGGCTAC
ACTCTCTTCCGCGGCCAATACACATACTCTCTTGAGGAGGGTGGTGAATTCAGCATCATTGCCAGCGCCCGCAATGGCGAGACATTCTCTGATGAATTCAAGATGACTTCCCTTCTCAAC
GGCACCAACTGC
GCAAACTGA

Retrieve as FASTA