Entry information : AthiAPx-CcP04
Entry ID 11652
Creation 2013-02-27 (Christophe Dunand)
Last sequence changes 2013-08-23 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-07 (Achraf Jemmat)
Peroxidase information: AthiAPx-CcP04
Name AthiAPx-CcP04
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Amanitaceae Amanita
Organism Amanita thiersii    [TaxId: 235537 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AthiAPx-CcP04
start..stop
S start..stop
AthiAPx-CcP05 875 0 1..529 1..525
AthiAPx-CcP03 715 0 1..529 1..526
AthiAPx-CcP02 702 0 1..503 1..504
CuniAPx-CcP01 369 7e-123 5..486 6..498
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4426..4629 204 N° 2 4237..4364 128 N° 3 3931..4175 245 N° 4 3334..3875 542
N° 5 2804..3274 471  
complement(join(2804..3274,3334..3875,3931..4175,4237..4364,4426..4629))


exon

Literature and cross-references AthiAPx-CcP04
DNA ref. JGI genome:   scaffold_333 (4629..2804)
Cluster/Prediction ref. JGI gene:   71171 [Incorrect prediction]
Protein sequence: AthiAPx-CcP04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   530 (510)
PWM (Da):   %s   57263.24 (55204.1)  
PI (pH):   %s   6.19 (5.82) Peptide Signal:   %s   cut: 20 range:20-529
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKQSRALLFSLGLAQASLGAYIWPAKTDDLEDIIFNDSGFGEAGIGNHILQCGDEGRGGPGAQVAAAWLRTTYHDMATYRVAEGAGGVDASILFETDRMENIGIGFNNTFLDLLPGYSSRVSFADMLAAAAYFALRKCGGPALRVRAGRIDATEAGPFGVPDPTETFNVHMHKFARAGRDPSQMIMMIACGSIGGVHGNDFPTITGNSDPAFTSHFDSTFTMYDNHISLDFISSNTSNPLASGPLMSRSDFRIFSSDMNATITRMSTPQGFRDTCQDTLSKMIDTVPSNVQLTEVIQPSEVRPFQLQLTLGPDGTVAFAGQIRVHTTDMQNGDKLDVKLLYTDRNGRSSATNVVQTTYAGRGASTGLDFQFYYDINAALPNGISKFNIQINGKTYDNGGNGFPIQDNVVIQFPDSCFDPTTRQLTVYGVVSDRLKKPVVELEVVDKRPRIGSIVPALVKDSVKMARLGGAVLHPQGYGMYKGTYTYTTSDGGEFSLAAYTRDKSGKRIRIGDDYKKTTVFNGTTCVS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). Incorrect prediction from JGI. Large 3'end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAAAGTCGTGCGCTCTTATTCTCCCTTGGTCTTGCACAAGCCAGTCTCGGCGCCTACATTTGGCCAGCGAAGACTGACGATCTCGAGGACATCATCTTCAATGATAGCGGCTTC
GGCGAGGCTGGTATCGGGAACCACATCCTGCAATGTGGTGACGAAGGTCGTGGCGGTCCAGGGGCCCAGGTTGCAGCTGCTTGG
GTAGGTATCGCGACTTTGCTCAATTAGCCAGTTATC
ATGTACCTAACTAAATGCGCCACAGCTCCGCACCACGTACCACGATATGGCAACATACCGTGTCGCCGAGGGTGCCGGCGGTGTAGACGCCTCTATCCTTTTCGAAACGGACCGTATGGA
GAACATCGGTATCGGATTCAACAACACATTCTT
GTAAGTATCAAGTACGAGCTTTTGGACTTGGTATGGCGGAGTACTAACTAGGGGTGATTAGGGACTTGCTGCCGGGATACAGTTCAC
GTGTATCATTCGCTGATATGCTTGCGGCTGCTGCCTACTTTGCCCTCCGAAAGTGTGGCGGCCCGGCTCTGCGCGTGCGCGCTGGTCGTATTGACGCGACTGAGGCTGGTCCATTCGGTG
TTCCCGACCCGACTGAGACGTTCAATGTCCACATGCACAAGTTTGCTCGTGCAGGTCGCGACCCGAGTCAAATGATCATGATGATTGCTTGCGGTCACT
GTAAGTGCTATCAACCATCTT
TCGTTCAACGGTCCCCCTAACTCAGTGCCTTTAGCAATCGGTGGTGTTCACGGGAACGATTTCCCAACAATCACCGGCAACTCCGACCCGGCCTTCACCTCTCACTTTGACTCGACCTTC
ACCATGTACGACAACCATATCTCTCTCGACTTCATCTCCAGCAACACCAGCAACCCCTTGGCCTCTGGGCCCTTGATGAGTCGCTCCGACTTCCGTATCTTCTCATCAGACATGAACGCC
ACTATCACACGGATGTCCACGCCTCAGGGCTTCCGTGACACCTGCCAGGACACGCTCAGCAAAATGATTGACACCGTTCCCAGTAACGTCCAACTGACTGAAGTTATCCAGCCCAGTGAG
GTCAGGCCATTCCAGCTTCAACTCACACTCGGCCCCGACGGAACTGTTGCATTTGCCGGGCAAATCCGTGTTCACACCACCGACATGCAAAATGGTGACAAGCTCGATGTCAAGCTGCTC
TACACTGACAGGAACGGCCGTAGCAGTGCTACCAACGTAGTCCAGACCACCTATGCTGGTCGTGGTGCTAGTACGGGACTCGACTTCCAGTTCGAC
GTGAGTAGCATAGACATGCACCTG
AATGCACTATAACTTACAGCCCTTGTCTCCCTTAGTATTATGATATCAACGCAGCGTTGCCAAACGGTATCTCCAAGTTCAACATCCAGATCAACGGCAAAACATACGACAACGGGGGCA
ATGGTTTCCCCATCCAAGACAACGTTGTCATCCAATTCCCTGATTCATGCTTCGACCCTACTACCAGGCAATTGACTGTGTACGGTGTTGTTAGCGACCGCCTCAAGAAGCCCGTAGTTG
AGCTCGAAGTTGTCGACAAGCGCCCCCGCATTGGGTCGATTGTCCCCGCACTCGTCAAGGACTCTGTCAAGATGGCCAGGTTGGGCGGTGCTGTCTTGCACCCACAGGGCTACGGCATGT
ACAAGGGTACCTACACATACACAACTTCAGACGGTGGTGAATTCAGTCTTGCTGCGTATACCAGAGATAAGAGCGGAAAGCGCATTCGTATTGGAGATGACTACAAGAAGACAACGGTCT
TCAATGGCACCACATGTGTAAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAAAGTCGTGCGCTCTTATTCTCCCTTGGTCTTGCACAAGCCAGTCTCGGCGCCTACATTTGGCCAGCGAAGACTGACGATCTCGAGGACATCATCTTCAATGATAGCGGCTTC
GGCGAGGCTGGTATCGGGAACCACATCCTGCAATGTGGTGACGAAGGTCGTGGCGGTCCAGGGGCCCAGGTTGCAGCTGCTTGG
CTCCGCACCACGTACCACGATATGGCAACATACCGT
GTCGCCGAGGGTGCCGGCGGTGTAGACGCCTCTATCCTTTTCGAAACGGACCGTATGGAGAACATCGGTATCGGATTCAACAACACATTCTT
GGACTTGCTGCCGGGATACAGTTCACGT
GTATCATTCGCTGATATGCTTGCGGCTGCTGCCTACTTTGCCCTCCGAAAGTGTGGCGGCCCGGCTCTGCGCGTGCGCGCTGGTCGTATTGACGCGACTGAGGCTGGTCCATTCGGTGTT
CCCGACCCGACTGAGACGTTCAATGTCCACATGCACAAGTTTGCTCGTGCAGGTCGCGACCCGAGTCAAATGATCATGATGATTGCTTGCGGTCACT
CAATCGGTGGTGTTCACGGGAAC
GATTTCCCAACAATCACCGGCAACTCCGACCCGGCCTTCACCTCTCACTTTGACTCGACCTTCACCATGTACGACAACCATATCTCTCTCGACTTCATCTCCAGCAACACCAGCAACCCC
TTGGCCTCTGGGCCCTTGATGAGTCGCTCCGACTTCCGTATCTTCTCATCAGACATGAACGCCACTATCACACGGATGTCCACGCCTCAGGGCTTCCGTGACACCTGCCAGGACACGCTC
AGCAAAATGATTGACACCGTTCCCAGTAACGTCCAACTGACTGAAGTTATCCAGCCCAGTGAGGTCAGGCCATTCCAGCTTCAACTCACACTCGGCCCCGACGGAACTGTTGCATTTGCC
GGGCAAATCCGTGTTCACACCACCGACATGCAAAATGGTGACAAGCTCGATGTCAAGCTGCTCTACACTGACAGGAACGGCCGTAGCAGTGCTACCAACGTAGTCCAGACCACCTATGCT
GGTCGTGGTGCTAGTACGGGACTCGACTTCCAGTTCGAC
TATTATGATATCAACGCAGCGTTGCCAAACGGTATCTCCAAGTTCAACATCCAGATCAACGGCAAAACATACGACAACGGG
GGCAATGGTTTCCCCATCCAAGACAACGTTGTCATCCAATTCCCTGATTCATGCTTCGACCCTACTACCAGGCAATTGACTGTGTACGGTGTTGTTAGCGACCGCCTCAAGAAGCCCGTA
GTTGAGCTCGAAGTTGTCGACAAGCGCCCCCGCATTGGGTCGATTGTCCCCGCACTCGTCAAGGACTCTGTCAAGATGGCCAGGTTGGGCGGTGCTGTCTTGCACCCACAGGGCTACGGC
ATGTACAAGGGTACCTACACATACACAACTTCAGACGGTGGTGAATTCAGTCTTGCTGCGTATACCAGAGATAAGAGCGGAAAGCGCATTCGTATTGGAGATGACTACAAGAAGACAACG
GTCTTCAATGGCACCACATGTGTAAGTTGA

Retrieve as FASTA