Entry information : AthiAPx-CcP05
Entry ID 11653
Creation 2013-02-27 (Christophe Dunand)
Last sequence changes 2013-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: AthiAPx-CcP05
Name AthiAPx-CcP05
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Amanitaceae Amanita
Organism Amanita thiersii    [TaxId: 235537 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AthiAPx-CcP05
start..stop
S start..stop
AthiAPx-CcP04 875 0 1..525 1..529
AthiAPx-CcP03 744 0 1..525 1..526
AthiAPx-CcP02 723 0 1..501 1..504
CuniAPx-CcP01 366 2e-121 5..484 6..498
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32681..32884 204 N° 2 32944..33071 128 N° 3 33132..33376 245 N° 4 33436..33971 536
N° 5 34029..34502 474  
join(32681..32884,32944..33071,33132..33376,33436..33971,34029..34502)


exon

Literature and cross-references AthiAPx-CcP05
DNA ref. JGI genome:   scaffold_90 (32681..34502)
Cluster/Prediction ref. JGI gene:   149618
Protein sequence: AthiAPx-CcP05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   529 (509)
PWM (Da):   %s   58196.67 (56106.6)  
PI (pH):   %s   6.57 (6.33) Peptide Signal:   %s   cut: 20 range:20-528
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKQGRALLFSLGLAQASFGQYVWPARIDDLEEIIFNDSGFGEAGIGNHIQQCGDEGRGGPGAQVAAAWLRTTYHDMATYRVAEGAGGVDASILFETDRMENIGIGFNNTFLDLEPGYSSRVSMADMLSAAAYFALRKCGGPALRVRAGRHDATEAGPFGVPDPTETFNVHMHKFARAGRNQTQMIMMITCGSIGGVHGNDFPTITGNSDPAFTSHFDSTFTMYDNHISLDFISSNTSNPLASGPLMSRSDFRIFSSDMNATITRMSTPQGFRDICQDTLSKMIDTVPSNVQLSPVIEPIPLKPFYPQLTVHKDGSVDFNGQIRIHTTDMADGDKLDVKLLYTDRNGRHSSANVIQTKYLDRGFGLDFHFYYDIKANLPNGISKFNVQVGDQVYDNGGNGFFMQDKVVFQRADSCFDKTTKTLTVYGVVSTDLKNPDVVLEVFDKRPRIGSIIPALVRDSVKLQKINDPSLKIKGYSLYKGTYKYTTEDGGEFTVSATTKGRRPQRFADEYKKTTIYDGVTCVSKQN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAAGGTCGTGCTCTCCTTTTCTCTTTGGGTCTTGCTCAGGCTTCTTTCGGTCAATATGTTTGGCCCGCGAGGATTGATGACCTCGAAGAAATCATCTTCAATGATAGTGGTTTC
GGTGAAGCCGGAATCGGTAACCACATCCAGCAATGTGGTGACGAAGGACGTGGTGGTCCAGGTGCACAAGTCGCAGCAGCATGG
GTAAGATTCTCATTCTACCATATCAAATAAATGAAA
ATATCTCACCAACCCTTTCATAGCTTCGTACCACTTACCATGACATGGCCACATACCGTGTCGCAGAAGGCGCCGGTGGTGTGGATGCCTCCATCCTATTCGAGACCGACCGTATGGAAA
ACATCGGTATCGGATTCAACAACACCTTCCT
GTAAGCCATCCCAATAGATTCTCTTACCCCCAACTTTTCTCACTCAACAAAACAAAACAGGGATTTGGAGCCAGGATACAGCTCCCGCG
TTTCAATGGCAGACATGCTCTCAGCAGCTGCTTACTTTGCCCTCCGCAAATGCGGTGGCCCAGCTCTTCGTGTTCGTGCTGGTCGCCACGACGCTACTGAAGCTGGTCCTTTTGGTGTTC
CTGACCCGACCGAGACGTTCAACGTTCATATGCACAAGTTCGCCCGGGCCGGCCGCAATCAGACTCAAATGATCATGATGATCACCTGCGGTCACT
GTAAGTTATCCATCAACACACTCC
CGTCCAACACCCTCTGACGTTCATCTCTCTACAAGCAATCGGTGGTGTCCACGGAAACGACTTCCCAACGATCACCGGCAACTCTGACCCGGCTTTCACCTCCCACTTCGACTCGACCTT
CACCATGTACGACAACCACATTTCTCTCGACTTCATCTCGAGCAACACTAGCAACCCCTTGGCCTCTGGGCCCTTGATGAGTCGCTCCGACTTCCGTATCTTCTCCTCAGATATGAACGC
CACGATCACGCGCATGTCGACGCCTCAGGGCTTCCGCGACATCTGCCAGGACACGCTCAGCAAAATGATCGACACCGTCCCCAGCAACGTCCAGCTCTCCCCCGTCATCGAGCCCATCCC
ACTTAAGCCCTTCTACCCACAGTTGACCGTGCACAAGGATGGCTCCGTCGACTTTAACGGCCAGATCCGTATCCACACCACCGATATGGCCGACGGTGACAAGTTGGACGTCAAGTTGCT
CTACACTGACCGCAATGGCCGCCACTCTTCTGCTAACGTTATCCAAACCAAATACCTCGACCGCGGCTTTGGTCTTGACTTCCACTTTGAC
GTAAGTGGTACCAGAAAAAAAAAATTTAA
AGATTATACTAAGTTTTTTCTTTGCTAGTACTATGATATCAAGGCTAACCTCCCCAACGGTATCTCCAAATTCAATGTCCAAGTCGGCGACCAGGTCTACGACAACGGTGGTAATGGCTT
CTTCATGCAGGACAAGGTTGTCTTCCAAAGGGCTGACTCCTGCTTCGACAAGACCACTAAGACCCTTACTGTGTACGGTGTCGTCAGCACTGACCTCAAGAACCCTGATGTCGTCCTCGA
AGTCTTTGACAAGCGCCCCCGCATTGGCTCTATCATCCCCGCTCTCGTTAGGGACAGCGTGAAGTTGCAGAAGATCAACGACCCTAGCCTCAAGATCAAGGGCTACTCATTGTACAAGGG
TACCTACAAGTACACCACTGAGGACGGTGGTGAATTCACCGTTTCTGCTACCACCAAGGGCAGGAGGCCACAACGCTTCGCTGACGAGTACAAGAAAACTACCATCTACGATGGTGTCAC
CTGCGTGAGTAAACAAAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAAGGTCGTGCTCTCCTTTTCTCTTTGGGTCTTGCTCAGGCTTCTTTCGGTCAATATGTTTGGCCCGCGAGGATTGATGACCTCGAAGAAATCATCTTCAATGATAGTGGTTTC
GGTGAAGCCGGAATCGGTAACCACATCCAGCAATGTGGTGACGAAGGACGTGGTGGTCCAGGTGCACAAGTCGCAGCAGCATGG
CTTCGTACCACTTACCATGACATGGCCACATACCGT
GTCGCAGAAGGCGCCGGTGGTGTGGATGCCTCCATCCTATTCGAGACCGACCGTATGGAAAACATCGGTATCGGATTCAACAACACCTTCCT
GGATTTGGAGCCAGGATACAGCTCCCGC
GTTTCAATGGCAGACATGCTCTCAGCAGCTGCTTACTTTGCCCTCCGCAAATGCGGTGGCCCAGCTCTTCGTGTTCGTGCTGGTCGCCACGACGCTACTGAAGCTGGTCCTTTTGGTGTT
CCTGACCCGACCGAGACGTTCAACGTTCATATGCACAAGTTCGCCCGGGCCGGCCGCAATCAGACTCAAATGATCATGATGATCACCTGCGGTCACT
CAATCGGTGGTGTCCACGGAAAC
GACTTCCCAACGATCACCGGCAACTCTGACCCGGCTTTCACCTCCCACTTCGACTCGACCTTCACCATGTACGACAACCACATTTCTCTCGACTTCATCTCGAGCAACACTAGCAACCCC
TTGGCCTCTGGGCCCTTGATGAGTCGCTCCGACTTCCGTATCTTCTCCTCAGATATGAACGCCACGATCACGCGCATGTCGACGCCTCAGGGCTTCCGCGACATCTGCCAGGACACGCTC
AGCAAAATGATCGACACCGTCCCCAGCAACGTCCAGCTCTCCCCCGTCATCGAGCCCATCCCACTTAAGCCCTTCTACCCACAGTTGACCGTGCACAAGGATGGCTCCGTCGACTTTAAC
GGCCAGATCCGTATCCACACCACCGATATGGCCGACGGTGACAAGTTGGACGTCAAGTTGCTCTACACTGACCGCAATGGCCGCCACTCTTCTGCTAACGTTATCCAAACCAAATACCTC
GACCGCGGCTTTGGTCTTGACTTCCACTTTGAC
TACTATGATATCAAGGCTAACCTCCCCAACGGTATCTCCAAATTCAATGTCCAAGTCGGCGACCAGGTCTACGACAACGGTGGTAAT
GGCTTCTTCATGCAGGACAAGGTTGTCTTCCAAAGGGCTGACTCCTGCTTCGACAAGACCACTAAGACCCTTACTGTGTACGGTGTCGTCAGCACTGACCTCAAGAACCCTGATGTCGTC
CTCGAAGTCTTTGACAAGCGCCCCCGCATTGGCTCTATCATCCCCGCTCTCGTTAGGGACAGCGTGAAGTTGCAGAAGATCAACGACCCTAGCCTCAAGATCAAGGGCTACTCATTGTAC
AAGGGTACCTACAAGTACACCACTGAGGACGGTGGTGAATTCACCGTTTCTGCTACCACCAAGGGCAGGAGGCCACAACGCTTCGCTGACGAGTACAAGAAAACTACCATCTACGATGGT
GTCACCTGCGTGAGTAAACAAAATTAG

Retrieve as FASTA