Entry information : CqueDyPrx02
Entry ID 11658
Creation 2013-02-28 (Christophe Dunand)
Last sequence changes 2013-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: CqueDyPrx02
Name CqueDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Cronartiaceae Cronartium
Organism Cronartium quercuum     [TaxId: 60197 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CqueDyPrx02
start..stop
S start..stop
CqueDyPrx03 513 1e-180 16..479 1..470
MlpDyPrx01 393 3e-133 18..479 12..495
PHpDyPrx 383 1e-129 16..477 4..486
PgrDyPrx03 373 5e-125 19..478 30..518
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45529..45593 65 N° 2 44905..45463 559 N° 3 44560..44815 256 N° 4 44364..44484 121
N° 5 44208..44290 83 N° 6 44058..44134 77 N° 7 43899..43934 36 N° 8 43741..43809 69
N° 9 43606..43653 48 N° 10 43469..43536 68 N° 11 43270..43327 58  
complement(join(43270..43327,43469..43536,43606..43653,43741..43809,43899..43934 ,44058..44134,44208..44290,44364..44484,44560..44815,44905..45463,45529..45593))


exon

Literature and cross-references CqueDyPrx02
DNA ref. JGI genome:   scaffold_45 (45593..43270)
Cluster/Prediction ref. JGI gene:   656486
Protein sequence: CqueDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   480
PWM (Da):   %s   51935.86  
PI (pH):   %s   7.99
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSDFKPRLLPDQYLVSASDSKMDENEVQGDIVLGFRKRVQAFLLISITDLELFRRLLRDILAPLLTSTAEVRAAAGLIGAIKAYAPPGTLKPFTSTQLAFSARALLHLGIPAEALPAQGAFRAGQAHDARINLADPVESGKLAHWRPQYENASIDGLLTVTAPDSTQLELELGFLRNVIAPATKIVLELKSAVRPGSAAGKEHFGYKDGVSNPRVAGMEPMGNQAGEGRAVDASVIITGLKAGQPSWTRNGSFLVFRELQQLVPEFDAFCHSSGKISKPDEIGARLMGRWKSGAPVSLSPHTDDLKLASAQGFDYADPAELKQARCPYVAHIRKANPRNGLGNRKELIDPHLMIRASIPYGPEVSQDERDSNATKQERGLFFICYQSSIEAGFQFVQKVWCNNQKFPSNEAGIDPGFDLIVGQNYGKSRTAQNVIDKGVQGDNDPLNTVTTNIQFVVPKGGEYFFVPSISTVRNTLGA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCAGACTTTAAGCCTCGATTGCTCCCGGATCAGTATCTGGTCTCAGCCAGTGATTCCAAGTAAGTCACTCCACCCTTCCATTCAGCCTTCTTCTCGGCAGCCTACTCAAAGCAT
CATGTTGTAGAATGGACGAGAATGAGGTACAGGGAGACATCGTGTTAGGGTTCCGTAAGAGGGTTCAGGCTTTTTTGCTTATTTCTATAACAGATCTCGAGCTCTTCCGTCGACTCTTGC
GCGATATCCTTGCACCTCTTCTCACCTCAACAGCCGAGGTTCGTGCGGCAGCCGGATTGATAGGCGCCATCAAGGCTTACGCCCCACCAGGAACGCTAAAGCCCTTCACCTCAACCCAAC
TCGCCTTTAGCGCTCGTGCGCTGCTCCACCTCGGGATTCCTGCCGAAGCCTTACCGGCCCAGGGAGCGTTCCGCGCCGGACAAGCACACGACGCTCGCATTAACCTAGCCGACCCAGTTG
AAAGTGGTAAACTGGCTCATTGGCGGCCTCAGTATGAGAACGCGTCCATCGATGGCTTACTTACAGTAACGGCGCCTGATTCCACCCAGCTCGAGCTCGAGCTCGGCTTCTTGCGCAACG
TCATTGCGCCCGCGACAAAGATCGTACTCGAGCTCAAGAGCGCAGTTCGACCAGGAAGTGCCGCGGGAAAAGAACATTTTGGATATAAG
GTAAATCACTTGGGAATTCCACTTTTACCCC
GTTCCCTTCGATCAGTTGATAGGAGCAGAAAAAACCAACTCAAAATTCCTTTGAATAGGATGGCGTGTCAAATCCGAGAGTAGCAGGTATGGAACCAATGGGAAACCAGGCGGGCGAGGG
AAGAGCAGTGGACGCGTCGGTGATCATCACGGGTCTAAAGGCAGGCCAGCCGAGCTGGACTCGCAATGGCTCCTTTCTCGTCTTTCGCGAACTTCAACAACTTGTGCCCGAGTTTGACGC
CTTCTGTCATAGCTCTGGTAAAATTTCGAAACCAGATGAGATTGGAGCTCGATTGATGGGTCGTTGGAAATCGG
GTCAGCGTCCCTGAGCTCTTCCGCATTCTTTTGATTATAGTCCACA
ACTTGATTAAAGACCATGGTGGTCCTTAGGCGCTCCCGTCTCCCTTAGCCCGCATACAGATGATCTGAAGCTGGCAAGCGCACAGGGTTTTGATTACGCGGATCCAGCCGAGCTCAAACA
GGCTCGATGTCCCTATGTGGCCCACATAAG
GTCCGCCTCATGTTTGAAAATAGGTTCGTAGATGGTGGAAATTGCATCTGTTGATCATCAGACGAGTCACCAGGAAGGCGAATCCGCGGA
ACGGGCTCGGGAACCGAAAGGAGCTCATTGATCCTCACCTCATGATTCGTGCATCGATCCCTTATG
GTGAACAGCCTCCCCCACTGGCACTCGCGCTTCCATCCAGATTGGCTAACTGTG
TTGAAAAAAAAAAAAACAGGGCCTGAGGTCAGTCAAGATGAAAGAGATTCCAACGCAACTAAACAGGAACGAGGATTATTCTTCATATGTTATCAGGTTTGTTCTTCAATCTTTTTGCGT
ATTGTTTGTCTTTCAGAAGGGGTCCGGGCTCACAATCATGACTATCCATGCTTCCGCCCTCTCTCCAACAAAACATTTTACTGTGTTCCCCGTTCTTAGTCTTCTATTGAGGCTGGTTTC
CAATTCGTACAAAAG
GTAAGCAGCTGTCTCTCTATATTGATGTTGCCACTTGCCAAACATCTGTGCTGACCCTTTTCACCTCACAACACACAAAACCTTGTCAGGTCTGGTGCAACAATC
AAAAATTCCCATCTAACGAGGCCGGAATCGATCCCGGTTTCGATCTGATCGTT
GTAAGCAGAGCTCTGCTTGTATACTGTCGCTTGTTAATCCACATCACACAAAAACTCATCCATTCTT
TTCTTGATTCACAATCACAGGGACAGAACTATGGTAAATCTCGGACAGCCCAGAATGTCATCGATAAAGTCAGTAGATACGTTTTCTAAAAAGCTTGGTCTGCTTGTCTCAAAAATTGAG
ATTTCTACCTGAACAAGGGCGTTCAAGGGGATAATGACCCACTCAACACCGTTACCACCAACATCCAATTTGTTGTTCCTAAAGGGCAAGTTTTTCTCAGTCTCCACCTCCACCTCCACC
TCTGACTCTTCTGTTCTCCAATGTTTTTTTTTTACTCGCTTCTTTCTTCTTTCTTTTTTTTTTTTGGTGCTAATGAACAAAAATTGCTAATGTACGATATCCACAGTGGTGAATACTTCT
TCGTTCCTTCCATCAGCACAGTCAGGAATACCCTTGGTGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCAGACTTTAAGCCTCGATTGCTCCCGGATCAGTATCTGGTCTCAGCCAGTGATTCCAAAATGGACGAGAATGAGGTACAGGGAGACATCGTGTTAGGGTTCCGTAAGAGGGTT
CAGGCTTTTTTGCTTATTTCTATAACAGATCTCGAGCTCTTCCGTCGACTCTTGCGCGATATCCTTGCACCTCTTCTCACCTCAACAGCCGAGGTTCGTGCGGCAGCCGGATTGATAGGC
GCCATCAAGGCTTACGCCCCACCAGGAACGCTAAAGCCCTTCACCTCAACCCAACTCGCCTTTAGCGCTCGTGCGCTGCTCCACCTCGGGATTCCTGCCGAAGCCTTACCGGCCCAGGGA
GCGTTCCGCGCCGGACAAGCACACGACGCTCGCATTAACCTAGCCGACCCAGTTGAAAGTGGTAAACTGGCTCATTGGCGGCCTCAGTATGAGAACGCGTCCATCGATGGCTTACTTACA
GTAACGGCGCCTGATTCCACCCAGCTCGAGCTCGAGCTCGGCTTCTTGCGCAACGTCATTGCGCCCGCGACAAAGATCGTACTCGAGCTCAAGAGCGCAGTTCGACCAGGAAGTGCCGCG
GGAAAAGAACATTTTGGATATAAG
GATGGCGTGTCAAATCCGAGAGTAGCAGGTATGGAACCAATGGGAAACCAGGCGGGCGAGGGAAGAGCAGTGGACGCGTCGGTGATCATCACGGGT
CTAAAGGCAGGCCAGCCGAGCTGGACTCGCAATGGCTCCTTTCTCGTCTTTCGCGAACTTCAACAACTTGTGCCCGAGTTTGACGCCTTCTGTCATAGCTCTGGTAAAATTTCGAAACCA
GATGAGATTGGAGCTCGATTGATGGGTCGTTGGAAATCGG
GCGCTCCCGTCTCCCTTAGCCCGCATACAGATGATCTGAAGCTGGCAAGCGCACAGGGTTTTGATTACGCGGATCCAGCC
GAGCTCAAACAGGCTCGATGTCCCTATGTGGCCCACATAAG
GAAGGCGAATCCGCGGAACGGGCTCGGGAACCGAAAGGAGCTCATTGATCCTCACCTCATGATTCGTGCATCGATCCCT
TATG
GGCCTGAGGTCAGTCAAGATGAAAGAGATTCCAACGCAACTAAACAGGAACGAGGATTATTCTTCATATGTTATCAGTCTTCTATTGAGGCTGGTTTCCAATTCGTACAAAAGGTC
TGGTGCAACAATCAAAAATTCCCATCTAACGAGGCCGGAATCGATCCCGGTTTCGATCTGATCGTT
GGACAGAACTATGGTAAATCTCGGACAGCCCAGAATGTCATCGATAAAGGCGTT
CAAGGGGATAATGACCCACTCAACACCGTTACCACCAACATCCAATTTGTTGTTCCTAAAGG
TGGTGAATACTTCTTCGTTCCTTCCATCAGCACAGTCAGGAATACCCTTGGTGCTTAG

Retrieve as FASTA