Entry information : AmusAPx-CcP01
Entry ID 11669
Creation 2013-02-28 (Christophe Dunand)
Last sequence changes 2013-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-26 (Catherine Mathe (Scipio))
Peroxidase information: AmusAPx-CcP01
Name AmusAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Amanitaceae Amanita
Organism Amanita muscaria    [TaxId: 41956 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AmusAPx-CcP01
start..stop
S start..stop
AthiAPx-CcP01 714 0 13..598 8..598
LbiAPx-CcP 616 0 1..578 1..576
AbAPx-CcP01_bisporus 610 0 22..572 23..572
LameAPx-CcP01 600 0 4..561 8..553
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 107072..107284 213 N° 2 106936..107022 87 N° 3 106817..106883 67 N° 4 106434..106761 328
N° 5 106272..106385 114 N° 6 106051..106225 175 N° 7 105568..105996 429 N° 8 105116..105511 396
complement(join(105116..105511,105568..105996,106051..106225,106272..106385,1064 34..106761,106817..106883,106936..107022,107072..107284))


exon

Literature and cross-references AmusAPx-CcP01
DNA ref. JGI genome:   scaffold_65 (107284..105116)
Cluster/Prediction ref. JGI gene:   199578
Protein sequence: AmusAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   603 (581)
PWM (Da):   %s   64962.97 (62638.8)  
PI (pH):   %s   4.97 (4.97) Peptide Signal:   %s   cut: 22 range:22-602
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPQLCSSLFLITSLLFSSVLGYQWPDPQYEQLEQFLYEGRRADGSNLASLVHPCRKREGTLSSIGAEWLRFAFHDMSTHDSTAGTGGLDASITYELNYTGNFGQGFINTQTDFESFPNKYVSRSDIIALGAVFAVSSCGGPIIPFRGGRVDALAAGPATQPEPQQTLQQHRQLFTQMGFSQSEMIQLVACGHTLGSVRSPDFPNLVPPNASDPNTPVFADFDSTMTKFDNNVVTEYLDGTTQNPLVVTSNATLQSDLRVFSSDGNATMKGLSTSGSFMSSCQGLLQRMIDTVPHGVSFTEEIQLIPAKILDVGLSIQQNQLLFKASLRLVQPTNTTANSKRVVTMFWCDRYGNNAFCGHSSKFSLAAQTTQVDPNSSPVSYTMGISFIRYDFVVPINSTVSISKFWFQVDEKNGSNPTVYDNSGAGYSVNQDQVIYTPALGTTTYSTTPVRRGGGGPVNVTYSKTYYVVAGVRQELNPSNVYMNAYDSAIKGYTSVFNQTVQLSPQNGSSPVAGYKFYTGSVTDGGLQLTVDVHAEIDGQQYLVDFLQTSNLGSVPYITPTNVTESSTTISSTHNAASASLPSLATTLVSLGAALAMLLVLS

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCAACTATGCTCTTCTCTTTTCCTCATCACTTCCTTGCTATTCTCATCCGTCTTGGGATACCAATGGCCTGATCCCCAGTACGAGCAACTCGAACAGTTCCTTTACGAAGGCAGG
AGAGCTGATGGCTCAAATCTTGCTTCTCTTGTCCATCCGTGTCGGAAGAGGGAGGGTACCTTGTCATCAATAGGCGCCGAATGGCTTCGTTTC
GTAAGTCGTTCTCCCAGAACTTGAACA
ACATAACCCATGCCGTGTCTAGGCTTTTCACGACATGTCAACCCATGATTCAACCGCAGGAACAGGGGGTTTGGATGCTTCTATAACATACGAACTGAACTATACCGGCGTACGTTCCGC
AACTCTTCCGAATCGACGTTGCATTGACTACTTCCTTGCAGAACTTTGGGCAAGGATTCATCAATACCCAGACTGACTTTGAGAGCTTTCCAAATAAATATGTTTCACGTTCGTCTCACA
TATTTCGAATTTTGAAAATACTTTTTGACACTTTCTTATGCAGGCTCTGACATTATCGCCCTCGGGGCAGTGTTCGCTGTATCTTCATGCGGAGGGCCAATAATACCCTTCCGAGGTGGA
CGTGTGGATGCATTAGCAGCAGGCCCCGCCACTCAACCAGAACCCCAACAAACGCTGCAGCAACATCGTCAACTATTCACTCAGATGGGTTTCTCACAATCCGAGATGATCCAACTCGTT
GCATGCGGTCACACCCTCGGTTCTGTGCGCTCACCCGATTTCCCTAATCTGGTCCCACCCAATGCCTCTGACCCAAACACTCCTGTTTTTGCCGACTTTGACTCAACCATGACCAAATTC
GACAACAACGT
GTAGGTTATCACGCTTGCCTTGGTCAAATGTACTTCAATATCCTACAGTGTGACAGAATATCTAGATGGAACCACCCAGAATCCATTAGTGGTCACTTCGAACGCAACC
CTCCAATCGGATTTGCGAGTCTTTTCTAGTGATGGTAATGCCACGATGAAAGG
GTGAGTTCCAATGACCAAGAAGAGCAATGCCTGAGATTATGTCCAGCCTGTCAACATCGGGCTCTTT
CATGTCTTCATGCCAAGGCCTATTGCAGCGGATGATCGACACAGTTCCGCATGGCGTGTCCTTCACAGAAGAAATACAGCTGATCCCTGCCAAAATTTTGGATGTGGGACTGTCAATCCA
GCAAAATCAACTCTTGTTCAAGGCATCCCTTCGA
GTAAGACTGTCCCCTTGACGTTCCTGACCTACGCTAAGGCGAGAAATACTTTAGCTGGTACAACCTACAAATACCACCGCCAACTC
TAAACGAGTAGTAACGATGTTTTGGTGCGATCGTTATGGCAACAACGCCTTTTGCGGCCATTCTTCAAAGTTTTCTCTCGCCGCTCAAACAACTCAAGTGGACCCCAACTCTTCTCCCGT
TTCGTACACTATGGGCATCTCTTTCATACGATACGACTTTGTCGTTCCCATTAATTCCACAGTTTCAATTTCCAAATTCTGGTTCCAAGTGGACGAAAAGAATGGATCAAACCCGACCGT
TTACGATAATAGCGGTGCAGGCTACTCAGTCAATCAAGACCAAGTGATCTATACCCCCGCGTTGGGCACAACAACTTACTCTACAACGCCTGTGCGGCGAGGCGGTGGTGGTCCTGTGAA
TGTAACTTATTCCAAAACTTATTACGTCGTTGCTGGT
GTAAGTAGCTTCCACCCATATCCCCTCCGGTAAAGCTGCTGACCACGGCTGTATAGGTTCGGCAAGAACTTAACCCCTCTAAC
GTTTACATGAACGCATATGACAGTGCCATCAAAGGCTACACGTCTGTTTTTAACCAGACCGTCCAGCTATCACCGCAAAATGGCTCATCACCTGTGGCAGGGTACAAGTTCTACACTGGT
TCGGTGACAGACGGCGGTCTCCAACTTACGGTAGATGTCCACGCCGAGATAGATGGTCAACAATACTTGGTGGATTTCCTCCAAACGTCCAACCTGGGGAGTGTGCCATACATTACTCCG
ACAAACGTGACAGAGTCTTCCACTACCATAAGCTCGACACACAACGCTGCAAGTGCATCGCTCCCGAGCCTCGCGACGACATTGGTTTCGCTGGGTGCAGCACTGGCTATGCTTCTAGTG
CTGTCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCAACTATGCTCTTCTCTTTTCCTCATCACTTCCTTGCTATTCTCATCCGTCTTGGGATACCAATGGCCTGATCCCCAGTACGAGCAACTCGAACAGTTCCTTTACGAAGGCAGG
AGAGCTGATGGCTCAAATCTTGCTTCTCTTGTCCATCCGTGTCGGAAGAGGGAGGGTACCTTGTCATCAATAGGCGCCGAATGGCTTCGTTTC
GCTTTTCACGACATGTCAACCCATGAT
TCAACCGCAGGAACAGGGGGTTTGGATGCTTCTATAACATACGAACTGAACTATACCGGC
AACTTTGGGCAAGGATTCATCAATACCCAGACTGACTTTGAGAGCTTTCCAAATAAATAT
GTTTCAC
GCTCTGACATTATCGCCCTCGGGGCAGTGTTCGCTGTATCTTCATGCGGAGGGCCAATAATACCCTTCCGAGGTGGACGTGTGGATGCATTAGCAGCAGGCCCCGCCACTCAA
CCAGAACCCCAACAAACGCTGCAGCAACATCGTCAACTATTCACTCAGATGGGTTTCTCACAATCCGAGATGATCCAACTCGTTGCATGCGGTCACACCCTCGGTTCTGTGCGCTCACCC
GATTTCCCTAATCTGGTCCCACCCAATGCCTCTGACCCAAACACTCCTGTTTTTGCCGACTTTGACTCAACCATGACCAAATTCGACAACAACGT
TGTGACAGAATATCTAGATGGAACC
ACCCAGAATCCATTAGTGGTCACTTCGAACGCAACCCTCCAATCGGATTTGCGAGTCTTTTCTAGTGATGGTAATGCCACGATGAAAGG
CCTGTCAACATCGGGCTCTTTCATGTCTTCA
TGCCAAGGCCTATTGCAGCGGATGATCGACACAGTTCCGCATGGCGTGTCCTTCACAGAAGAAATACAGCTGATCCCTGCCAAAATTTTGGATGTGGGACTGTCAATCCAGCAAAATCAA
CTCTTGTTCAAGGCATCCCTTCGA
CTGGTACAACCTACAAATACCACCGCCAACTCTAAACGAGTAGTAACGATGTTTTGGTGCGATCGTTATGGCAACAACGCCTTTTGCGGCCATTCT
TCAAAGTTTTCTCTCGCCGCTCAAACAACTCAAGTGGACCCCAACTCTTCTCCCGTTTCGTACACTATGGGCATCTCTTTCATACGATACGACTTTGTCGTTCCCATTAATTCCACAGTT
TCAATTTCCAAATTCTGGTTCCAAGTGGACGAAAAGAATGGATCAAACCCGACCGTTTACGATAATAGCGGTGCAGGCTACTCAGTCAATCAAGACCAAGTGATCTATACCCCCGCGTTG
GGCACAACAACTTACTCTACAACGCCTGTGCGGCGAGGCGGTGGTGGTCCTGTGAATGTAACTTATTCCAAAACTTATTACGTCGTTGCTGGT
GTTCGGCAAGAACTTAACCCCTCTAAC
GTTTACATGAACGCATATGACAGTGCCATCAAAGGCTACACGTCTGTTTTTAACCAGACCGTCCAGCTATCACCGCAAAATGGCTCATCACCTGTGGCAGGGTACAAGTTCTACACTGGT
TCGGTGACAGACGGCGGTCTCCAACTTACGGTAGATGTCCACGCCGAGATAGATGGTCAACAATACTTGGTGGATTTCCTCCAAACGTCCAACCTGGGGAGTGTGCCATACATTACTCCG
ACAAACGTGACAGAGTCTTCCACTACCATAAGCTCGACACACAACGCTGCAAGTGCATCGCTCCCGAGCCTCGCGACGACATTGGTTTCGCTGGGTGCAGCACTGGCTATGCTTCTAGTG
CTGTCATAG

Retrieve as FASTA