Entry information : AmusDyPrx01
Entry ID 11677
Creation 2013-02-28 (Christophe Dunand)
Last sequence changes 2013-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-26 (Catherine Mathe (Scipio))
Peroxidase information: AmusDyPrx01
Name AmusDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Amanitaceae Amanita
Organism Amanita muscaria    [TaxId: 41956 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AmusDyPrx01
start..stop
S start..stop
AmusDyPrx02 733 0 3..476 2..482
AthiDyPrx01 647 0 4..477 2..471
GmarDyPrx03 548 0 7..477 27..501
HanDyPrx01 525 0 6..476 8..481
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13644..13693 50 N° 2 13362..13581 220 N° 3 12991..13310 320 N° 4 12646..12941 296
N° 5 12533..12593 61 N° 6 12225..12481 257 N° 7 12121..12175 55 N° 8 11893..12067 175
complement(join(11893..12067,12121..12175,12225..12481,12533..12593,12646..12941 ,12991..13310,13362..13581,13644..13693))


exon

Literature and cross-references AmusDyPrx01
DNA ref. JGI genome:   scaffold_200 (13693..11893)
Cluster/Prediction ref. JGI gene:   89285
Protein sequence: AmusDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   478
PWM (Da):   %s   51620.69  
PI (pH):   %s   7.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTTPLNLANIQGDILGGLPKKTQTNVFFQILNVPVFRKQLGTLVPRITTADQVLKHRQDIKNHKDKGNTGLLKISGVNIAFSHFGFVKLGIDDSKLAGPGGPANDPYIKGQLSDSQSLNDPGTGAGPTFQPNWLPEFKQQLHGIIVFTGDSHATVDENKKAVLAIFGIPGTAPSIQVITSITGDVRPGKEAGHEHFGFLDGISNPAVIGFDTNPPPGPAPVRSGIILLGHDGDDVPIRDPWMVDGSFLAFRYLFQRVPEFNKFLQDNPIKVPGLSDAEGSELLGARLVGRWKSGAPVDLRPFDDDPALAADAQKNNNFAFTAELTTQKICPFAAHVRKTNPRADLNNNVETHRILRRGIQFGPEVTPDEQKQNKTIENRGLIFHSYQSDISNGFRFLQTLWANNPAFPFTETTPQQPGFDAIIGQPPAGQTRSLSGTDPDNPATSLTLPVLWVVPRGGEYFFSPSINALKGTISA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAACGACTCCTTTGAATTTGGCGAACATCCAAGGCGACATCCTGTTTGTTATTCCCTCCTCCCTTCGCCAACGTCTAAATAATTTGCTTTCGTCCCTTTGTTTAGTGGTGGCT
TGCCGAAAAAGACCCAGACAAACGTATTTTTCCAGATTCTCAATGTCCCTGTATTCAGGAAGCAGCTTGGAACACTCGTTCCACGCATCACAACTGCGGATCAAGTGCTCAAACATAGGC
AGGACATCAAGAATCATAAGGACAAGGGCAATACTGGACTCCTCAAGATATCGGGAGTGAATATCGCATTTTCCCACTTTGGATTTGTCAAG
GTACTACTTTCACCGAGACTTGGTTATG
TGTTTATGAACATGTCTCGTTAGTTGGGTATAGATGACTCGAAATTGGCTGGACCTGGGGGCCCAGCTAATGATCCGTACATCAAAGGGCAACTCAGTGATTCACAGAGCCTCAACGACC
CCGGCACCGGTGCTGGGCCGACCTTCCAACCTAATTGGCTTCCAGAGTTTAAACAGCAACTCCACGGTATAATTGTTTTCACCGGCGACTCTCACGCAACAGTCGATGAAAACAAGAAAG
CTGTCTTGGCGATATTCGGTATACCCGGAACGGCGCCCTCAATCCAGGTCATTACTAGCATTACGGGAGATGTAAGGCCAGGCAAGGAGGCAGGACATGAACA
GTTGGTTAATTCTATTG
TTCTTGTGACTAATTCTGATGCGAAACGACAGCTTCGGCTTCTTGGACGGAATCTCGAACCCGGCCGTCATCGGATTCGATACGAATCCCCCTCCTGGACCTGCTCCCGTACGCTCTGGA
ATCATCCTCCTCGGCCATGATGGCGACGATGTACCTATTCGCGATCCCTGGATGGTAGACGGAAGTTTCCTCGCTTTCCGTTACCTGTTCCAGCGTGTTCCCGAATTCAACAAGTTCCTC
CAGGACAATCCGATCAAGGTGCCTGGTCTGTCAGACGCAGAGGGTAGTGAATTGCTCGGTGCTCGACTTGTAGGTCGCTGGAAGAGTG
GTAAGCGAAGAATACATGAAGGGAAGACGAGG
ATAGTTAACGCGATCTACAGGTGCTCCAGTTGATTTGCGACCATTTGACGACGATCCAGCCCTTGCCGCCGATGCGCAGAAGTATACTTCTTGACTTCGATCTTAATAATAAGTCTTACA
GGCACCCAACAGGAACAATAACTTTGCCTTTACTGCTGAGCTCACCACACAGAAAATCTGTCCATTTGCAGCACACGTCCGCAAGACTAATCCACGTGCTGATCTCAACAACAACGTTGA
GACACACAGGATTTTGCGTCGGGGCATCCAATTCGGACCAGAGGTTACACCCGATGAGCAAAAACAGAACAAGACCATCGAGAATCGAGGATTAATCTTCCACTCCTACCAGAGCGACAT
CTCCAATGGATTCCGTTTCCTTCAAACAC
GTAAGATCACCCAAGAGTCTGGACGATAAATGCTTACAACCTCACACAGTTTGGGCAAACAATCCCGCATTCCCATTCACCGAGACTACCC
CGCAGCAACCTGG
GTATGTTCGCATTCATCTTGGATGCTGTCACCTGTGTTCTGAACTGCTCCTAGGTTCGATGCCATCATCGGTCAACCTCCCGCCGGACAGACCCGATCACTGTCTGG
CACTGATCCAGATAATCCAGCAACATCACTTACGTTACCTGTCCTATGGGTAGTACCGCGCGGAGGAGAATACTTCTTTTCTCCATCCATCAATGCATTGAAGGGAACCATCTCAGCGTA
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAACGACTCCTTTGAATTTGGCGAACATCCAAGGCGACATCCTTGGTGGCTTGCCGAAAAAGACCCAGACAAACGTATTTTTCCAGATTCTCAATGTCCCTGTATTCAGGAAG
CAGCTTGGAACACTCGTTCCACGCATCACAACTGCGGATCAAGTGCTCAAACATAGGCAGGACATCAAGAATCATAAGGACAAGGGCAATACTGGACTCCTCAAGATATCGGGAGTGAAT
ATCGCATTTTCCCACTTTGGATTTGTCAAG
TTGGGTATAGATGACTCGAAATTGGCTGGACCTGGGGGCCCAGCTAATGATCCGTACATCAAAGGGCAACTCAGTGATTCACAGAGCCTC
AACGACCCCGGCACCGGTGCTGGGCCGACCTTCCAACCTAATTGGCTTCCAGAGTTTAAACAGCAACTCCACGGTATAATTGTTTTCACCGGCGACTCTCACGCAACAGTCGATGAAAAC
AAGAAAGCTGTCTTGGCGATATTCGGTATACCCGGAACGGCGCCCTCAATCCAGGTCATTACTAGCATTACGGGAGATGTAAGGCCAGGCAAGGAGGCAGGACATGAACA
CTTCGGCTTC
TTGGACGGAATCTCGAACCCGGCCGTCATCGGATTCGATACGAATCCCCCTCCTGGACCTGCTCCCGTACGCTCTGGAATCATCCTCCTCGGCCATGATGGCGACGATGTACCTATTCGC
GATCCCTGGATGGTAGACGGAAGTTTCCTCGCTTTCCGTTACCTGTTCCAGCGTGTTCCCGAATTCAACAAGTTCCTCCAGGACAATCCGATCAAGGTGCCTGGTCTGTCAGACGCAGAG
GGTAGTGAATTGCTCGGTGCTCGACTTGTAGGTCGCTGGAAGAGTG
GTGCTCCAGTTGATTTGCGACCATTTGACGACGATCCAGCCCTTGCCGCCGATGCGCAGAAGAACAATAACTTT
GCCTTTACTGCTGAGCTCACCACACAGAAAATCTGTCCATTTGCAGCACACGTCCGCAAGACTAATCCACGTGCTGATCTCAACAACAACGTTGAGACACACAGGATTTTGCGTCGGGGC
ATCCAATTCGGACCAGAGGTTACACCCGATGAGCAAAAACAGAACAAGACCATCGAGAATCGAGGATTAATCTTCCACTCCTACCAGAGCGACATCTCCAATGGATTCCGTTTCCTTCAA
ACAC
TTTGGGCAAACAATCCCGCATTCCCATTCACCGAGACTACCCCGCAGCAACCTGGGTTCGATGCCATCATCGGTCAACCTCCCGCCGGACAGACCCGATCACTGTCTGGCACTGAT
CCAGATAATCCAGCAACATCACTTACGTTACCTGTCCTATGGGTAGTACCGCGCGGAGGAGAATACTTCTTTTCTCCATCCATCAATGCATTGAAGGGAACCATCTCAGCGTAA

Retrieve as FASTA