Entry information : CangCcP02
Entry ID 11682
Creation 2013-03-06 (Christophe Dunand)
Last sequence changes 2013-03-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-27 (Catherine Mathe (Scipio))
Peroxidase information: CangCcP02
Name CangCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Blastocladiomycota Blastocladiomycetes Catenariaceae Catenaria
Organism Catenaria anguillulae    [TaxId: 109876 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CangCcP02
start..stop
S start..stop
AmaCcP 416 6e-146 2..362 6..367
AmaCcP02 411 6e-144 31..362 35..367
CgraCcP01 392 1e-136 1..358 7..350
CgloCcP01_ST23 389 1e-135 1..358 7..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5308..5484 177 N° 2 4904..5174 271 N° 3 4317..4808 492 N° 4 4094..4242 149
complement(join(4094..4242,4317..4808,4904..5174,5308..5484))


exon

Literature and cross-references CangCcP02
DNA ref. JGI genome:   scaffold_436 (5484..4094)
Cluster/Prediction ref. JGI gene:   131441 [Incorrect prediction]
Protein sequence: CangCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362
PWM (Da):   %s   39981.04  
PI (pH):   %s   8.82
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFARSVLRSAAAATRSALPAATRSSRRTLATEAAKSGSSKLVPISLALLAAGAGGYYYTTQHSWSEIKEDLKDKQHAISDAVQHAVPKPKEPLNYHKVAAAIADVLESNPDYDDGSYGPLFVRLAWHASGTYSKHDGSGGSNGATMRYHPESSDGANNGLNLARDLLEPIKRRFPDISYADLWTLAGVVAIKEMGGPSVPWRSGRSDAPSAEACPPVGRLPDASKERKHIREVFNRMGFDDREIVALMGAHALGRCHTDRSGYKGPWTFSPTMLTNDYFKLLLSETWVKKQWDGPLQYEDKKTRSLMMLPTDMEMYNDRYFYKYTKEFAKDEAAFFSAFSDAFKKLLELGVKFPESSETIIL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from JGI (first exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTGCTCGCTCTGTTCTCCGCTCGGCTGCGGCCGCCACCCGCTCTGCCCTCCCGGCGGCCACGCGCTCCTCGCGCCGTACGCTCGCCACCGAAGCCGCAAAGTCGGGCTCGTCCAAG
CTCGTTCCCATCTCGCTTGCCTTGCTCGCTGCGGGCGCTGGCGGCTACTACTACACT
GTACGTCTATTCCTGCGTGACGCCACTCAAACACAACACAACTCAACCACTGGACCCACGTCA
CGACACACACAACATTCTGGCCACGTCTCGCCACTCGGCTCACAACCTTGTCTCGTCACCCCTCTCACAGACGCAACACTCGTGGTCCGAAATCAAGGAGGACCTCAAGGACAAGCAGCA
CGCCATTTCCGATGCCGTCCAACACGCCGTCCCAAAGCCCAAGGAGCCGCTCAACTACCACAAGGTTGCCGCCGCCATTGCCGATGTGCTGGAATCCAACCCAGACTATGACGACGGTTC
GTACGGCCCACTCTTTGTCCGCCTGGCCTGGCACGCGTCCGGCACGTATTCCAAGCACGACGGGTCTGGCGGGTCGAACGGCGCCACCATGCGCTACCACC
GTACGTTTCCAACTTTTCC
TCGTGCTATTTCCTTGGTCCCGTGGCTCAGCCAAACTGACGCACAAATTCCACCAACTTGCACTAAATAATAATAGCCGAATCCTCGGACGGCGCCAACAATGGCCTCAACCTTGCCCGC
GACCTCCTTGAACCCATCAAGCGGCGCTTCCCCGACATCTCGTACGCCGACCTGTGGACGCTTGCGGGTGTGGTTGCCATCAAGGAAATGGGTGGCCCCTCTGTGCCTTGGCGCTCTGGC
CGGTCCGATGCCCCCTCGGCCGAAGCCTGCCCGCCCGTGGGCCGCTTGCCTGACGCGTCAAAGGAACGCAAGCACATTCGCGAAGTGTTCAACCGCATGGGGTTTGACGACCGCGAAATT
GTCGCGCTCATGGGCGCCCACGCTCTGGGCCGGTGTCACACGGATCGGTCCGGGTACAAGGGCCCTTGGACGTTCTCACCCACCATGCTTACCAACGATTACTTCAAGTTGCTGTTGAGC
GAGACGTGGGTCAAGAAGCAATGGGACGGGCCCTTGCAGTACGAGGACAAGAAGACCCGGTCCTTGATGATGTTGCCAACTGACATGG
GTACGATTCGGTTTTCCCCTCTTTTTCATTGC
TCGTCCAATCTGACGCGCAAATCACTTGTTCACTTTGACCAGAAATGTACAACGACCGGTACTTTTACAAGTACACCAAGGAGTTTGCCAAGGACGAGGCTGCCTTCTTCTCGGCCTTCT
CTGATGCCTTCAAGAAGCTGCTCGAGCTCGGCGTCAAGTTCCCCGAGTCGTCCGAGACCATCATTCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTGCTCGCTCTGTTCTCCGCTCGGCTGCGGCCGCCACCCGCTCTGCCCTCCCGGCGGCCACGCGCTCCTCGCGCCGTACGCTCGCCACCGAAGCCGCAAAGTCGGGCTCGTCCAAG
CTCGTTCCCATCTCGCTTGCCTTGCTCGCTGCGGGCGCTGGCGGCTACTACTACACT
ACGCAACACTCGTGGTCCGAAATCAAGGAGGACCTCAAGGACAAGCAGCACGCCATTTCCGAT
GCCGTCCAACACGCCGTCCCAAAGCCCAAGGAGCCGCTCAACTACCACAAGGTTGCCGCCGCCATTGCCGATGTGCTGGAATCCAACCCAGACTATGACGACGGTTCGTACGGCCCACTC
TTTGTCCGCCTGGCCTGGCACGCGTCCGGCACGTATTCCAAGCACGACGGGTCTGGCGGGTCGAACGGCGCCACCATGCGCTACCACC
CCGAATCCTCGGACGGCGCCAACAATGGCCTC
AACCTTGCCCGCGACCTCCTTGAACCCATCAAGCGGCGCTTCCCCGACATCTCGTACGCCGACCTGTGGACGCTTGCGGGTGTGGTTGCCATCAAGGAAATGGGTGGCCCCTCTGTGCCT
TGGCGCTCTGGCCGGTCCGATGCCCCCTCGGCCGAAGCCTGCCCGCCCGTGGGCCGCTTGCCTGACGCGTCAAAGGAACGCAAGCACATTCGCGAAGTGTTCAACCGCATGGGGTTTGAC
GACCGCGAAATTGTCGCGCTCATGGGCGCCCACGCTCTGGGCCGGTGTCACACGGATCGGTCCGGGTACAAGGGCCCTTGGACGTTCTCACCCACCATGCTTACCAACGATTACTTCAAG
TTGCTGTTGAGCGAGACGTGGGTCAAGAAGCAATGGGACGGGCCCTTGCAGTACGAGGACAAGAAGACCCGGTCCTTGATGATGTTGCCAACTGACATGG
AAATGTACAACGACCGGTAC
TTTTACAAGTACACCAAGGAGTTTGCCAAGGACGAGGCTGCCTTCTTCTCGGCCTTCTCTGATGCCTTCAAGAAGCTGCTCGAGCTCGGCGTCAAGTTCCCCGAGTCGTCCGAGACCATC
ATTCTCTAA

Retrieve as FASTA