Entry information : MverCcP01
Entry ID 11687
Creation 2013-03-07 (Christophe Dunand)
Last sequence changes 2013-03-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-04-23 (Christophe Dunand)
Peroxidase information: MverCcP01
Name MverCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Mortierellaceae Mortierella
Organism Mortierella verticillata     [TaxId: 78898 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MverCcP01
start..stop
S start..stop
MeloCcP01 615 0 9..351 15..360
MverCcP02 531 0 6..351 7..360
MimpCcP01 394 4e-137 15..350 41..379
MconCcP01 394 4e-137 15..350 41..379
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2756403..2756586 184 N° 2 2754646..2754995 350 N° 3 2754009..2754530 522  
complement(join(2754009..2754530,2754646..2754995,2756403..2756586))


exon

Literature and cross-references MverCcP01
Cluster/Prediction ref. Broad:   S7000007152762823
Protein sequence: MverCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351
PWM (Da):   %s   38317.29  
PI (pH):   %s   7.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFIRALPLARRAAISAAPRISARAYSAQASSSGGAGKTLFVAALAAGAGAAGYHVYADSQKSTLPVVAAAEKPKEPLDYQKVYNAIAAIIEDENYDDGSYGPVFLRLAWHASGTYDVNAKDGGSNFATMRFKPEAGHGANAGLGIARERLNRVKDQFPEISYGDLWTLAGVAAIQEGGPIVNWRAGRIDGEEAQSPPDGRLPDAGRPDGQHSRDIFYKMGFNDQEIVALLGAHALGRCHPDRSGFDGPWTASPTVFTNAFYTELLGRKWVERKWSGPKQFEDKESKSLMMLPADMAMAKDKEFRKWVEVYAKDEQKFFEDFAKVAQKLFELGVKFEDNAKVYQFKPTNA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCATCCGCGCTCTTCCTTTGGCTCGCCGCGCAGCCATTTCTGCTGCCCCTCGCATCTCTGCCCGCGCCTACTCTGCCCAGGCCTCTTCTTCCGGCGGTGCTGGCAAGACCTTG
TTTGTTGCTGCGCTCGCTGCCGGTGCCGGCGCTGCTGGTTACCACGTCTATGCCGATAGCCAGA
GTAAGTTTGCACCAAGCAGTGTTCTTGATATGATGCATGTTGGGATAGTTTGCGCG
TTCAGGTGCGCAGGGCAATAGGAGCGACTCCGACGTGGAGACCTCGACTGCGCAATTGTCTATGGAAATACCTAGAGGCGCGTTTTTTTCTTTCTTTGGCTATGGAAGTGAGGCTTCAAG
CGAGGGTAGTAACGTTGATCAGGGCATGCCGGGTGTTTGCTTCGTCAAGGGCTACGGTATTTGTGTTGACCTCATTGGAAGAAGGAGACGGGTGTGCCATATAATTTTTTGGCCTCGATT
TTTTTTTTCCCTCACTTGCGCGGCCCACCCACCACTTGAATAATTCATGCCCACGGAATTTAGACCATACTTTTTTTTTTTTTTTTCGGGGAAAGTTTATTTTTCGCCTCCTTGGGTCCG
GTTCACCTCTCCTCGCACACCCACTTTTGCACCAAGGAAGGAGAGACGACGGGATAGGCTCCATCCTCATCCCACATGCCTGCAAGCATCGTCCAAACTTGTTTTTGTGTCGTTGACAAA
GCACACGCGCATCTCACTACTTATCGATTACTTGGATCGCTGAGGATTACAAGAACTATTTCTACATGGTCTGAGGAGTGCGAGTGAATGTCTGCTACCTTGGTACTTTTTGGGTTTTCA
CACTGCATTTCATTGATCTGTTCGGCGATGAAAAGACGGCATGGGGCGAGCGGGACGGAGCGTCCTCTATTCTATTTTTCAGTTTTCCGTTTCTCCGAGATCGTTAACTCTAAAATGACA
ATGTGAGCGTTCTTTTTTTCTTCGATTGATTTCGGACATGAATGGGTCTTGTTTGTAAATGCGTATCTCCCACATGATGGCATGATGACAAAAAGGTGTGGATGGGGGGATTGGTTCTTC
CATTTTGTTCGATTCGTGGGTGGTGGGTGGATGGATGGATGGGTGCGATGGCGTGTGGGCGTGTGAGAATTGTTCGTTTTCCTCGCTCTTCGTTGTATTGGCCCCCCTTCCCTTCTTTCT
TCTCTGTCCCGGAAGAGTACGGTGTGACAAATAACAGGTGCACAAGGAAAAAGCAAACCACAGAGAGACAAGGGACAGAGAGGAGTACCTTCTCTTCTATCTCATCTGTCACTCTCATAT
GGATGTGGCTCTATTGTATCTGCTCATCACTTTACCCTGCCGCCACCTCTCTTCTGTGTTTCCCTTTGTTCCGCATAAACAAACAAACAAACAGACAAACAAACCTAGCCAAACACCAAC
ACGAGTCCGTTGAGTGTTTTTTATGTGTGTGTGTGTCTGTGTCTGTCTGTGTTTGCGCCCTGATCCACAAAACATGCCCCTGGATCTACCATTGTTGATCGAACTTCCCCCCTTACTCAC
CAAACTACCTTCTTCCTCTTCATCCATCTAGAGTCTACCCTTCCCGTCGTCGCTGCTGCCGAGAAGCCCAAGGAGCCCCTCGACTACCAGAAGGTCTACAACGCCATTGCTGCCATCATC
GAGGACGAGAACTACGATGACGGCTCCTACGGCCCCGTCTTCTTGCGTCTCGCCTGGCACGCCTCCGGAACCTACGACGTCAACGCCAAGGACGGTGGTTCCAACTTTGCCACCATGCGC
TTCAAGCCCGAGGCTGGCCACGGTGCCAACGCTGGTCTCGGCATTGCCCGCGAGCGTCTGAACCGTGTCAAGGATCAGTTCCCCGAGATCTCCTATGGTGATCTCTGGACCTTGGCTGGT
GTTGCTGCCATTCAGGAGTTG
GTATGTCTTTTCTTTTGCTTCTTTAAGATGTTGTTCATTTGGCCCCGCCTGCGCACTTCACATATGTTGTTTTGAAATTAACTCTCATCTCCCTGGTTT
CTCTTAAATTCTCTAGGGTGGTCCCATTGTCAACTGGAGAGCTGGACGTATCGATGGCGAGGAGGCCCAGTCTCCCCCCGATGGCCGTCTCCCCGACGCTGGCAGACCTGATGGCCAGCA
CTCTCGTGACATTTTCTACAAGATGGGCTTCAACGACCAGGAGATTGTTGCTCTTCTCGGTGCCCACGCCTTGGGCCGCTGCCACCCCGACCGCTCTGGCTTTGACGGTCCCTGGACCGC
TTCCCCTACTGTCTTCACCAACGCCTTTTACACTGAGTTGTTGGGCCGCAAGTGGGTTGAGCGCAAGTGGTCGGGCCCTAAGCAGTTCGAAGACAAGGAGTCCAAGTCGCTGATGATGTT
GCCCGCAGACATGGCCATGGCCAAGGACAAGGAGTTCCGCAAGTGGGTCGAAGTGTATGCCAAGGATGAGCAAAAGTTCTTTGAGGACTTTGCCAAGGTTGCACAGAAGCTGTTTGAGCT
CGGTGTCAAGTTTGAGGACAACGCCAAGGTCTACCAGTTCAAGCCCACCAACGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCATCCGCGCTCTTCCTTTGGCTCGCCGCGCAGCCATTTCTGCTGCCCCTCGCATCTCTGCCCGCGCCTACTCTGCCCAGGCCTCTTCTTCCGGCGGTGCTGGCAAGACCTTG
TTTGTTGCTGCGCTCGCTGCCGGTGCCGGCGCTGCTGGTTACCACGTCTATGCCGATAGCCAGA
AGTCTACCCTTCCCGTCGTCGCTGCTGCCGAGAAGCCCAAGGAGCCCCTCGACTAC
CAGAAGGTCTACAACGCCATTGCTGCCATCATCGAGGACGAGAACTACGATGACGGCTCCTACGGCCCCGTCTTCTTGCGTCTCGCCTGGCACGCCTCCGGAACCTACGACGTCAACGCC
AAGGACGGTGGTTCCAACTTTGCCACCATGCGCTTCAAGCCCGAGGCTGGCCACGGTGCCAACGCTGGTCTCGGCATTGCCCGCGAGCGTCTGAACCGTGTCAAGGATCAGTTCCCCGAG
ATCTCCTATGGTGATCTCTGGACCTTGGCTGGTGTTGCTGCCATTCAGGAGTTG
GGTGGTCCCATTGTCAACTGGAGAGCTGGACGTATCGATGGCGAGGAGGCCCAGTCTCCCCCCGAT
GGCCGTCTCCCCGACGCTGGCAGACCTGATGGCCAGCACTCTCGTGACATTTTCTACAAGATGGGCTTCAACGACCAGGAGATTGTTGCTCTTCTCGGTGCCCACGCCTTGGGCCGCTGC
CACCCCGACCGCTCTGGCTTTGACGGTCCCTGGACCGCTTCCCCTACTGTCTTCACCAACGCCTTTTACACTGAGTTGTTGGGCCGCAAGTGGGTTGAGCGCAAGTGGTCGGGCCCTAAG
CAGTTCGAAGACAAGGAGTCCAAGTCGCTGATGATGTTGCCCGCAGACATGGCCATGGCCAAGGACAAGGAGTTCCGCAAGTGGGTCGAAGTGTATGCCAAGGATGAGCAAAAGTTCTTT
GAGGACTTTGCCAAGGTTGCACAGAAGCTGTTTGAGCTCGGTGTCAAGTTTGAGGACAACGCCAAGGTCTACCAGTTCAAGCCCACCAACGCTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTCTTTTCT TTTTCTTTTT TTTTTTTCCT CATTCATTCA CAACTCTCCA CTCACCCCAA CAAAAACCAA CACTCTTATC CAACAATGTC CTTCATCCGC GCTCTTCCTT TGGCTCGCCG  CGCAGCCATT TCTGCTGCCC CTCGCATCTC TGCCCGCGCC TACTCTGCCC AGGCCTCTTC TTCCGGCGGT GCTGGCAAGA CCTTGTTTGT TGCTGCGCTC GCTGCCGGTG CCGGCGCTGC  TGGTTACCAC GTCTATGCCG ATAGCCAGAA GTCTACCCTT CCCGTCGTCG CTGCTGCCGA GAAGCCCAAG GAGCCCCTCG ACTACCAGAA GGTCTACAAC GCCATTGCTG CCATCATCGA  GGACGAGAAC TACGATGACG GCTCCTACGG CCCCGTCTTC TTGCGTCTCG CCTGGCACGC CTCCGGAACC TACGACGTCA ACGCCAAGGA CGGTGGTTCC AACTTTGCCA CCATGCGCTT  CAAGCCCGAG GCTGGCCACG GTGCCAACGC TGGTCTCGGC ATTGCCCGCG AGCGTCTGAA CCGTGTCAAG GATCAGTTCC CCGAGATCTC CTATGGTGAT CTCTGGACCT TGGCTGGTGT  TGCTGCCATT CAGGAGTTGG GTGGTCCCAT TGTCAACTGG AGAGCTGGAC GTATCGATGG CGAGGAGGCC CAGTCTCCCC CCGATGGCCG TCTCCCCGAC GCTGGCAGAC CTGATGGCCA  GCACTCTCGT GACATTTTCT ACAAGATGGG CTTCAACGAC CAGGAGATTG TTGCTCTTCT CGGTGCCCAC GCCTTGGGCC GCTGCCACCC CGACCGCTCT GGCTTTGACG GTCCCTGGAC  CGCTTCCCCT ACTGTCTTCA CCAACGCCTT TTACACTGAG TTGTTGGGCC GCAAGTGGGT TGAGCGCAAG TGGTCGGGCC CTAAGCAGTT CGAAGACAAG GAGTCCAAGT CGCTGATGAT  GTTGCCCGCA GACATGGCCA TGGCCAAGGA CAAGGAGTTC CGCAAGTGGG TCGAAGTGTA TGCCAAGGAT GAGCAAAAGT TCTTTGAGGA CTTTGCCAAG GTTGCACAGA AGCTGTTTGA  GCTCGGTGTC AAGTTTGAGG ACAACGCCAA GGTCTACCAG TTCAAGCCCA CCAACGCTTA AAAAAAGATC ACCTTGTAAG AATGTTATGA AGCCATACCC CCCCTCTCCT TTCCCCCTTT 
CTTTCTCGAC CTTGAACATA TATGCACCCA TCTACCTTAG AGATAATAAA AAATGCACCT CATTGATAAA ACAAAATAAG AGAAGATAT 

Retrieve as FASTA