Entry information : MverCcP02 (MVEG_11388.1)
Entry ID 11688
Creation 2013-03-07 (Christophe Dunand)
Last sequence changes 2013-03-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-03-07 (Christophe Dunand)
Peroxidase information: MverCcP02 (MVEG_11388.1)
Name (synonym) MverCcP02 (MVEG_11388.1)
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Mortierellaceae Mortierella
Organism Mortierella verticillata     [TaxId: 78898 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MverCcP02
start..stop
S start..stop
MeloCcP01 549 0 2..360 6..360
MverCcP01 548 0 7..360 6..351
ThybCcP01 392 7e-137 3..358 4..352
AmacrCcP01 392 2e-136 4..360 17..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 574181..574382 202 N° 2 573539..573897 359 N° 3 572921..573442 522  
complement(join(572921..573442,573539..573897,574181..574382))


exon

Literature and cross-references MverCcP02 (MVEG_11388.1)
Cluster/Prediction ref. Broad:   S7000007152765613
Protein sequence: MverCcP02 (MVEG_11388.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360
PWM (Da):   %s   39714.96  
PI (pH):   %s   8.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLLARPALRLAARRSLFAVPAALPRTATRTFASQSSSSGGGGSSTLIAVVLGAAAGAAGYHYYYQKDQSLPKIASAVPQAEAKKQPLDYQKVYNAIAAIIEDENYDDGSYGPVFLRLAWHASGTYDKNAKNGGSNFATMRFKPEAGSEANAGLGIARERLNRVKDKFPDISYGDLWTLAGVAAIQEGGPIVKWRPGRIDGEEDSSPPDGRLPDGGRPDSQHTRDVFYKMGFNDQEIVALIGAHALGRCHRERSGFDGPWTASPTVFTNTFYTELLNRKWTERKWSGPKQFEDQESKSLMMLPADMVFSSDKEFRKWAEIYAKDEAKFFEDFAKAVQKLFELGVKFDENTKVYEFKPTNA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCTCGCCCGACCCGCTTTAAGGCTGGCTGCTCGCCGCTCTCTTTTCGCTGTCCCAGCCGCCCTCCCTCGCACAGCAACTCGCACATTCGCATCACAGTCCAGCAGCAGTGGTGGA
GGTGGATCCTCCACCTTGATTGCGGTTGTGCTCGGAGCCGCCGCTGGTGCTGCCGGATACCACTACTACTATCAAAAGGACC
GTAAGTATTGCTCTTGTCATTTACACAAACCGAAAGCT
CTGTCCTCATGAGAAGAAACGTGGATTCGACTCTCATCATCCCAACGTACTACGATCGTTAGCAAGGATGCCCTTGCTATCATTGACGAAGAGAAGGAGGAGGGGATATATTTCGGACGG
AAAAAAATTCAACAACAACAGCAACAGCAACATTGAATTTCAGGGGCTTCTCTGGTCAAAGTAAGAAAAAAGGAACACCCCTTCAATTTCTTTGCTAAGTTGCGCATGGATCCACAACCG
AATAGAATCTCTTCCGAAAATCGCCTCCGCTGTGCCCCAGGCCGAGGCCAAGAAGCAGCCCTTGGACTACCAGAAAGTCTACAACGCCATTGCCGCGATCATCGAGGACGAGAACTACGA
CGATGGCTCGTATGGCCCAGTCTTCCTGCGCTTGGCCTGGCACGCCTCAGGTACCTACGACAAGAATGCAAAGAACGGTGGGTCGAACTTTGCTACCATGCGATTCAAGCCCGAGGCGGG
ATCGGAGGCCAATGCTGGACTGGGCATTGCCCGTGAACGATTGAACCGCGTCAAGGATAAGTTCCCTGATATCTCGTACGGTGATCTCTGGACACTTGCTGGAGTAGCCGCGATCCAAGA
AATG
GTAGCGCACACGATATTTCCACTTCCCACAAGCTTTGGTATCAACTATTGACATTTCAATGACATACAACTATGCCTGATTGCTTTTTTCTTATAGGGTGGGCCGATTGTCAAGTG
GAGACCGGGACGCATTGATGGAGAAGAAGACAGCAGCCCACCAGACGGCCGTCTTCCTGATGGCGGAAGACCCGATTCTCAACACACACGCGACGTCTTTTATAAGATGGGTTTCAACGA
CCAAGAGATTGTTGCCTTGATAGGCGCCCACGCACTTGGCCGATGCCATCGGGAGCGTTCCGGATTTGATGGCCCATGGACAGCATCGCCTACAGTTTTCACCAACACCTTCTACACCGA
GCTCTTGAATCGCAAGTGGACGGAGCGCAAGTGGTCGGGTCCGAAGCAGTTTGAGGACCAAGAATCCAAGAGTCTGATGATGCTGCCCGCGGACATGGTGTTCTCTAGTGACAAGGAGTT
CCGCAAGTGGGCCGAGATCTACGCCAAGGACGAGGCCAAGTTCTTTGAGGACTTTGCCAAGGCGGTCCAGAAGCTGTTTGAGCTCGGAGTCAAGTTTGATGAAAACACCAAAGTGTATGA
GTTCAAGCCTACCAACGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCTCGCCCGACCCGCTTTAAGGCTGGCTGCTCGCCGCTCTCTTTTCGCTGTCCCAGCCGCCCTCCCTCGCACAGCAACTCGCACATTCGCATCACAGTCCAGCAGCAGTGGTGGA
GGTGGATCCTCCACCTTGATTGCGGTTGTGCTCGGAGCCGCCGCTGGTGCTGCCGGATACCACTACTACTATCAAAAGGACC
AATCTCTTCCGAAAATCGCCTCCGCTGTGCCCCAGGCC
GAGGCCAAGAAGCAGCCCTTGGACTACCAGAAAGTCTACAACGCCATTGCCGCGATCATCGAGGACGAGAACTACGACGATGGCTCGTATGGCCCAGTCTTCCTGCGCTTGGCCTGGCAC
GCCTCAGGTACCTACGACAAGAATGCAAAGAACGGTGGGTCGAACTTTGCTACCATGCGATTCAAGCCCGAGGCGGGATCGGAGGCCAATGCTGGACTGGGCATTGCCCGTGAACGATTG
AACCGCGTCAAGGATAAGTTCCCTGATATCTCGTACGGTGATCTCTGGACACTTGCTGGAGTAGCCGCGATCCAAGAAATG
GGTGGGCCGATTGTCAAGTGGAGACCGGGACGCATTGAT
GGAGAAGAAGACAGCAGCCCACCAGACGGCCGTCTTCCTGATGGCGGAAGACCCGATTCTCAACACACACGCGACGTCTTTTATAAGATGGGTTTCAACGACCAAGAGATTGTTGCCTTG
ATAGGCGCCCACGCACTTGGCCGATGCCATCGGGAGCGTTCCGGATTTGATGGCCCATGGACAGCATCGCCTACAGTTTTCACCAACACCTTCTACACCGAGCTCTTGAATCGCAAGTGG
ACGGAGCGCAAGTGGTCGGGTCCGAAGCAGTTTGAGGACCAAGAATCCAAGAGTCTGATGATGCTGCCCGCGGACATGGTGTTCTCTAGTGACAAGGAGTTCCGCAAGTGGGCCGAGATC
TACGCCAAGGACGAGGCCAAGTTCTTTGAGGACTTTGCCAAGGCGGTCCAGAAGCTGTTTGAGCTCGGAGTCAAGTTTGATGAAAACACCAAAGTGTATGAGTTCAAGCCTACCAACGCC
TAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCTCG CCCGACCCGC TTTAAGGCTG GCTGCTCGCC GCTCTCTTTT CGCTGTCCCA GCCGCCCTCC CTCGCACAGC AACTCGCACA TTCGCATCAC AGTCCAGCAG CAGTGGTGGA  GGTGGATCCT CCACCTTGAT TGCGGTTGTG CTCGGAGCCG CCGCTGGTGC TGCCGGATAC CACTACTACT ATCAAAAGGA CCAATCTCTT CCGAAAATCG CCTCCGCTGT GCCCCAGGCC  GAGGCCAAGA AGCAGCCCTT GGACTACCAG AAAGTCTACA ACGCCATTGC CGCGATCATC GAGGACGAGA ACTACGACGA TGGCTCGTAT GGCCCAGTCT TCCTGCGCTT GGCCTGGCAC  GCCTCAGGTA CCTACGACAA GAATGCAAAG AACGGTGGGT CGAACTTTGC TACCATGCGA TTCAAGCCCG AGGCGGGATC GGAGGCCAAT GCTGGACTGG GCATTGCCCG TGAACGATTG  AACCGCGTCA AGGATAAGTT CCCTGATATC TCGTACGGTG ATCTCTGGAC ACTTGCTGGA GTAGCCGCGA TCCAAGAAAT GGGTGGGCCG ATTGTCAAGT GGAGACCGGG ACGCATTGAT  GGAGAAGAAG ACAGCAGCCC ACCAGACGGC CGTCTTCCTG ATGGCGGAAG ACCCGATTCT CAACACACAC GCGACGTCTT TTATAAGATG GGTTTCAACG ACCAAGAGAT TGTTGCCTTG  ATAGGCGCCC ACGCACTTGG CCGATGCCAT CGGGAGCGTT CCGGATTTGA TGGCCCATGG ACAGCATCGC CTACAGTTTT CACCAACACC TTCTACACCG AGCTCTTGAA TCGCAAGTGG  ACGGAGCGCA AGTGGTCGGG TCCGAAGCAG TTTGAGGACC AAGAATCCAA GAGTCTGATG ATGCTGCCCG CGGACATGGT GTTCTCTAGT GACAAGGAGT TCCGCAAGTG GGCCGAGATC  TACGCCAAGG ACGAGGCCAA GTTCTTTGAG GACTTTGCCA AGGCGGTCCA GAAGCTGTTT GAGCTCGGAG TCAAGTTTGA TGAAAACACC AAAGTGTATG AGTTCAAGCC TACCAACGCC 
TAAGAAAAAC CAGGAGTTGT GTTGTCCATG AAATAAAGAA TTTTTATTGT GCTG 

Retrieve as FASTA