Entry information : PcroCcP01
Entry ID 11691
Creation 2013-04-05 (Christophe Dunand)
Last sequence changes 2013-04-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: PcroCcP01
Name PcroCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Atheliaceae Piloderma
Organism Piloderma croceum    [TaxId: 80663 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcroCcP01
start..stop
S start..stop
SlacCcP01 587 0 1..361 1..371
Fcbs109695CcP01 571 0 20..361 21..372
TmatCcP01 551 0 1..361 1..364
PoCcP_PC9 550 0 1..361 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 148091..148354 264 N° 2 147990..148038 49 N° 3 147855..147936 82 N° 4 147647..147800 154
N° 5 147463..147579 117 N° 6 147325..147407 83 N° 7 147189..147266 78 N° 8 147057..147128 72
N° 9 146912..146995 84 N° 10 146750..146852 103  
complement(join(146750..146852,146912..146995,147057..147128,147189..147266,1473 25..147407,147463..147579,147647..147800,147855..147936,147990..148038,148091..1 48354))


exon

Literature and cross-references PcroCcP01
DNA ref. JGI genome:   scaffold_00071 (148354..146750)
Cluster/Prediction ref. JGI gene:   826808
Protein sequence: PcroCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362
PWM (Da):   %s   40550.45  
PI (pH):   %s   8.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLNVLRAPIRRAVVCAPFPKARLRPSFRHYSTPPPERKSNFGLYAGLGVAVLGAAGYYLYTSNTGSVTEAAGALKANFKPTREDYQKVYNKIALLLDEADSYDDGSYGPLILRLAWHSSGTYDKETNTGGSNYATMRFAPESLHGANAGLQLARELMEKIKREFPWISYGDLWTLGGVAAVEMAGPKIPWRPGRIDGFDQHVTPDGRLPDASQGADHLRKIFYRMGFNDQEIVALCGAHALGRCHTDRSGFEGPWTFAPTTLTNDFYKLLFEETWTWKKWNGPKQLEDKKTKSLMMLPTDYVITQDKSFKKYAKSYADSEEVFFKDFSAVISKLFELGVPTEQFSTSEPWVLKSLDEQK

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTGAACGTGTTACGGGCCCCCATTCGTCGGGCCGTAGTCTGTGCTCCGTTCCCTAAGGCACGCCTTCGCCCGTCTTTCCGCCACTACTCAACACCTCCGCCAGAACGCAAGTCC
AACTTCGGTCTCTATGCCGGCTTGGGTGTGGCAGTTCTGGGCGCAGCTGGGTACTATCTGTATACTTCAAACACAGGCTCTGTTACGGAGGCTGCCGGTGCACTGAAGGCTAACTTCAAA
CCCACGCGCGAGGACTACCAGAAG
GTTCGCGCTGGCGGCTCGTACTCAATCATCAACTTACCATGAAGAACATTAGGTGTACAACAAGATTGCCTTACTTCTAGATGAAGCTGATAGCTA
TGATG
GTAAGAAACCAAAGCTTTGTTTAACACTCCAGGCCACTGATACGGCCCTGCAGATGGATCCTACGGTCCCCTCATTCTTCGTTTGGCATGGCATAGCTCTGGCACTTATGATAAG
GAGACTAACACCGGTGGGAG
GTCCGTGGGAACCATATAAAACTCTACCTGAAATCGAGCTAAATGACTACACAGCAATTATGCTACGATGCGTTTCGCGCCTGAATCCCTCCACGGCGCC
AATGCTGGTTTGCAGCTTGCCAGAGAACTGATGGAAAAGATCAAGAGAGAATTTCCTTGGATCAGCTATGGTGACTTGTGGACCCTTGGTGGCGTTGCTGCCGTTCAG
GTATTATTCAAA
TTCACCCAATCAATATCACTCGAGCTGGTCACTGAGGCGTGATATGCTCTGTCAGGAAATGGCTGGCCCCAAGATTCCCTGGAGACCCGGCAGAATTGATGGGTTTGACCAGCATGTTAC
TCCGGATGGTCGGTTACCAGATGCTTCTCAGGGCGCTGATCACCTACGGAAG
GTCAGTGCGTTCGTTGATGGTGACCATCCGATGTAACGCCTCAGTCTATACACAGATATTCTATCGCA
TGGGATTCAACGATCAGGAAATTGTCGCACTCTGTGGTGCTCATGCCCTTGGGCGGTGTCACACCGATCG
GTGTGTAACTGCCAATTATTTTATATAGTGCCTTCATGTTTAAATTATGT
AATCACAGCTCCGGTTTTGAAGGCCCTTGGACGTTCGCCCCAACTACCCTGACCAATGATTTCTACAAACTGCTCTTTGAGGAAACGTACGTTTCTAGTCTCGTGACCTTACTTATCGAT
GGTCTGACTGCTACGTCACTCCATAGATGGACTTGGAAAAAATGGAATGGCCCCAAGCAGCTCGAAGACAAAAAGACCAAAAGCCTCATGATGCTGCCGTATGTACACTTCCAATGTTGA
CTTTCAGTGGCAGGGATCTAACGGGCTACGCATTCACAGTACGGATTACGTTATCACCCAAGATAAGAGCTTCAAGAAGTATGCCAAATCATACGCTGACAGCGAGGAGGTCTTCTTCAA
GGA
GTATGTACCGACCTCTCAGAATCAAGTGTCATCATACTCACTACTGGGTTTGATGCCAGTTTCTCGGCGGTTATATCTAAACTATTCGAGCTCGGTGTGCCGACTGAGCAATTCTCG
ACATCGGAGCCTTGGGTCCTTAAGTCACTCGACGAGCAGAAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTGAACGTGTTACGGGCCCCCATTCGTCGGGCCGTAGTCTGTGCTCCGTTCCCTAAGGCACGCCTTCGCCCGTCTTTCCGCCACTACTCAACACCTCCGCCAGAACGCAAGTCC
AACTTCGGTCTCTATGCCGGCTTGGGTGTGGCAGTTCTGGGCGCAGCTGGGTACTATCTGTATACTTCAAACACAGGCTCTGTTACGGAGGCTGCCGGTGCACTGAAGGCTAACTTCAAA
CCCACGCGCGAGGACTACCAGAAG
GTGTACAACAAGATTGCCTTACTTCTAGATGAAGCTGATAGCTATGATGATGGATCCTACGGTCCCCTCATTCTTCGTTTGGCATGGCATAGCTCT
GGCACTTATGATAAGGAGACTAACACCGGTGGGAG
CAATTATGCTACGATGCGTTTCGCGCCTGAATCCCTCCACGGCGCCAATGCTGGTTTGCAGCTTGCCAGAGAACTGATGGAAAAG
ATCAAGAGAGAATTTCCTTGGATCAGCTATGGTGACTTGTGGACCCTTGGTGGCGTTGCTGCCGTTCAG
GAAATGGCTGGCCCCAAGATTCCCTGGAGACCCGGCAGAATTGATGGGTTT
GACCAGCATGTTACTCCGGATGGTCGGTTACCAGATGCTTCTCAGGGCGCTGATCACCTACGGAAG
ATATTCTATCGCATGGGATTCAACGATCAGGAAATTGTCGCACTCTGTGGTGCT
CATGCCCTTGGGCGGTGTCACACCGATCG
CTCCGGTTTTGAAGGCCCTTGGACGTTCGCCCCAACTACCCTGACCAATGATTTCTACAAACTGCTCTTTGAGGAAACATGGACTTGGAAA
AAATGGAATGGCCCCAAGCAGCTCGAAGACAAAAAGACCAAAAGCCTCATGATGCTGCC
TACGGATTACGTTATCACCCAAGATAAGAGCTTCAAGAAGTATGCCAAATCATACGCTGAC
AGCGAGGAGGTCTTCTTCAAGGA
TTTCTCGGCGGTTATATCTAAACTATTCGAGCTCGGTGTGCCGACTGAGCAATTCTCGACATCGGAGCCTTGGGTCCTTAAGTCACTCGACGAGCAG
AAATAG

Retrieve as FASTA