Entry information : COsaAPx-CcP01
Entry ID 11694
Creation 2013-04-08 (Christophe Dunand)
Last sequence changes 2013-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: COsaAPx-CcP01
Name COsaAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus sativus    [TaxId: 45130 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value COsaAPx-CcP01
start..stop
S start..stop
CheAPx-CcP01_C4 1006 0 1..530 1..530
ClunAPx-CcP01 897 0 1..530 1..529
PterAPx-CcP01 786 0 14..530 13..527
PtritAPx-CcP01 775 0 1..530 1..526
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 693251..693641 391 N° 2 691993..693194 1202  
complement(join(691993..693194,693251..693641))


exon

Literature and cross-references COsaAPx-CcP01
DNA ref. JGI genome:   scaffold_11 (693641..691993)
Cluster/Prediction ref. JGI gene:   147288
Protein sequence: COsaAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   531 (510)
PWM (Da):   %s   55817.82 (53699.7) Transmb domain:   %s   i2-24o
PI (pH):   %s   4.71 (4.71) Peptide Signal:   %s   cut: 21 range:21-530
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFASINIATAIAVIVSTASAALYYPDVQTHLLEHILVDNWGAYASNFSSAITPCDRYVTQTGNAALTSGRTTAAQWMRVLFHDFITANVSAGTGGVDASIGFETAREENKGSAFNDSFTFWRPYVNGAVSMADLIAIGTVMSNNLCGGNNMPYRPGRIDALSAGSTTGVPAPETNLEETLVFFERAGFEKVEDAIGLTACGHTMGSVHHGGFPEVVDETFVTPNNTNGGSNFDTTRGVFDPNILGEYVHWTGNKGGPLVTSHNETMNSDLRLYESDGNVTMRALLAQGPAFLDTCVELMRRAIDTVPSHVQLGDVVTAIPAKPINVTYDYSKIDGKLVLSGKIRVLTAAEHGSQNSITLRMGQDETNIALVAEAETGQSVFGRGAAGYGTTTYFPFSVSGPSIRNATSFSVSGAGIQQDFRISNQIFVVQSLTALDGKAVNTTVAVSAPNSCSDIHVRIAAPFTQPGTLAPKISEKDIIVSALPETPDGYTLCGGNIVLDAVPTGLLTIKALQGGTLVDTLLVDGGKAGW

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCTCAATCAATATCGCGACCGCAATCGCAGTCATTGTTTCCACGGCCAGTGCCGCACTCTACTATCCAGATGTCCAGACACATCTCCTTGAGCACATTCTTGTCGACAATTGG
GGCGCCTACGCATCCAACTTTTCTTCTGCAATCACGCCCTGTGACCGCTATGTGACGCAGACGGGGAATGCGGCACTAACCAGTGGCCGCACGACGGCAGCCCAATGGATGCGTGTTCTT
TTCCACGACTTCATAACGGCCAATGTGAGCGCAGGTACAGGTGGAGTGGATGCAAGCATTGGGTTTGAGACGGCGAGGGAAGAGAACAAGGGGAGTGCATTCAATGACAGTTTTACTTTT
TGGAGACCCTATGTCAACGGCGCTGTTTCCA
GTATGTGTTTCGGTACTTGAGTTTACTCCCATCTTCTTGTCTGACCAGAAACCTAGTGGCTGATCTAATTGCAATTGGAACCGTCATGT
CGAACAACCTATGTGGAGGCAACAACATGCCCTATCGCCCCGGGCGCATTGACGCTCTCTCTGCGGGCTCCACAACAGGCGTCCCAGCACCAGAAACGAATCTCGAAGAAACCCTCGTCT
TCTTCGAGCGCGCCGGCTTCGAAAAAGTGGAAGATGCCATTGGCCTGACGGCCTGCGGACATACCATGGGTTCGGTGCACCACGGCGGCTTCCCCGAAGTCGTAGACGAAACATTTGTCA
CGCCAAATAACACCAACGGCGGCAGCAACTTCGACACGACGCGCGGTGTCTTTGATCCCAACATTTTGGGGGAATATGTGCATTGGACGGGCAATAAAGGTGGTCCGTTGGTGACTTCGC
ACAATGAGACTATGAACTCTGACCTTCGGCTCTATGAGAGCGACGGTAACGTCACCATGCGAGCACTGCTTGCACAGGGACCCGCGTTTCTAGATACCTGTGTCGAGCTCATGCGCCGCG
CCATCGATACCGTGCCATCCCACGTGCAGCTCGGTGACGTCGTCACGGCAATCCCTGCCAAGCCGATTAACGTTACGTATGATTACTCCAAGATCGATGGCAAGTTGGTGCTTTCGGGTA
AGATTAGAGTGCTGACTGCAGCGGAACACGGAAGTCAAAATTCAATTACACTTCGCATGGGCCAAGATGAGACGAACATTGCACTTGTCGCCGAAGCCGAGACTGGGCAGTCTGTTTTTG
GTCGCGGTGCTGCTGGATATGGGACCACGACTTATTTCCCCTTTTCAGTATCTGGACCCTCGATCCGAAATGCAACTTCCTTTTCTGTGAGTGGTGCAGGTATCCAACAAGACTTTCGGA
TTAGCAACCAGATATTCGTGGTGCAGAGTTTAACAGCTCTGGACGGCAAGGCTGTCAATACTACTGTCGCTGTATCGGCGCCTAACTCTTGCTCGGATATTCATGTGCGTATCGCTGCAC
CTTTTACACAGCCCGGGACATTGGCACCGAAGATTAGCGAGAAGGATATCATAGTGAGCGCCTTGCCCGAAACTCCGGACGGTTATACACTGTGTGGTGGCAACATTGTTCTGGACGCCG
TGCCAACTGGCTTACTCACTATAAAGGCACTACAAGGAGGAACCCTCGTTGATACACTGTTGGTAGACGGGGGGAAAGCAGGCTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCTCAATCAATATCGCGACCGCAATCGCAGTCATTGTTTCCACGGCCAGTGCCGCACTCTACTATCCAGATGTCCAGACACATCTCCTTGAGCACATTCTTGTCGACAATTGG
GGCGCCTACGCATCCAACTTTTCTTCTGCAATCACGCCCTGTGACCGCTATGTGACGCAGACGGGGAATGCGGCACTAACCAGTGGCCGCACGACGGCAGCCCAATGGATGCGTGTTCTT
TTCCACGACTTCATAACGGCCAATGTGAGCGCAGGTACAGGTGGAGTGGATGCAAGCATTGGGTTTGAGACGGCGAGGGAAGAGAACAAGGGGAGTGCATTCAATGACAGTTTTACTTTT
TGGAGACCCTATGTCAACGGCGCTGTTTCCA
TGGCTGATCTAATTGCAATTGGAACCGTCATGTCGAACAACCTATGTGGAGGCAACAACATGCCCTATCGCCCCGGGCGCATTGACGCT
CTCTCTGCGGGCTCCACAACAGGCGTCCCAGCACCAGAAACGAATCTCGAAGAAACCCTCGTCTTCTTCGAGCGCGCCGGCTTCGAAAAAGTGGAAGATGCCATTGGCCTGACGGCCTGC
GGACATACCATGGGTTCGGTGCACCACGGCGGCTTCCCCGAAGTCGTAGACGAAACATTTGTCACGCCAAATAACACCAACGGCGGCAGCAACTTCGACACGACGCGCGGTGTCTTTGAT
CCCAACATTTTGGGGGAATATGTGCATTGGACGGGCAATAAAGGTGGTCCGTTGGTGACTTCGCACAATGAGACTATGAACTCTGACCTTCGGCTCTATGAGAGCGACGGTAACGTCACC
ATGCGAGCACTGCTTGCACAGGGACCCGCGTTTCTAGATACCTGTGTCGAGCTCATGCGCCGCGCCATCGATACCGTGCCATCCCACGTGCAGCTCGGTGACGTCGTCACGGCAATCCCT
GCCAAGCCGATTAACGTTACGTATGATTACTCCAAGATCGATGGCAAGTTGGTGCTTTCGGGTAAGATTAGAGTGCTGACTGCAGCGGAACACGGAAGTCAAAATTCAATTACACTTCGC
ATGGGCCAAGATGAGACGAACATTGCACTTGTCGCCGAAGCCGAGACTGGGCAGTCTGTTTTTGGTCGCGGTGCTGCTGGATATGGGACCACGACTTATTTCCCCTTTTCAGTATCTGGA
CCCTCGATCCGAAATGCAACTTCCTTTTCTGTGAGTGGTGCAGGTATCCAACAAGACTTTCGGATTAGCAACCAGATATTCGTGGTGCAGAGTTTAACAGCTCTGGACGGCAAGGCTGTC
AATACTACTGTCGCTGTATCGGCGCCTAACTCTTGCTCGGATATTCATGTGCGTATCGCTGCACCTTTTACACAGCCCGGGACATTGGCACCGAAGATTAGCGAGAAGGATATCATAGTG
AGCGCCTTGCCCGAAACTCCGGACGGTTATACACTGTGTGGTGGCAACATTGTTCTGGACGCCGTGCCAACTGGCTTACTCACTATAAAGGCACTACAAGGAGGAACCCTCGTTGATACA
CTGTTGGTAGACGGGGGGAAAGCAGGCTGGTGA

Retrieve as FASTA