Entry information : COsaAPx-CcP02
Entry ID 11695
Creation 2013-04-08 (Christophe Dunand)
Last sequence changes 2013-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: COsaAPx-CcP02
Name COsaAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus sativus    [TaxId: 45130 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value COsaAPx-CcP02
start..stop
S start..stop
CheAPx-CcP02_C4 895 0 1..529 1..514
ClunAPx-CcP02 773 0 1..525 1..526
SturAPx-CcP02 771 0 1..525 1..527
PnoAPx-CcP01 692 0 1..519 1..520
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 915696..915834 139 N° 2 915242..915640 399 N° 3 914134..915185 1052  
complement(join(914134..915185,915242..915640,915696..915834))


exon

Literature and cross-references COsaAPx-CcP02
DNA ref. JGI genome:   scaffold_14 (915834..914134)
Cluster/Prediction ref. JGI gene:   125649
Protein sequence: COsaAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   530 (511)
PWM (Da):   %s   57014.46 (55143.5)  
PI (pH):   %s   4.69 (4.64) Peptide Signal:   %s   cut: 19 range:19-529
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSNLAIGLALFAPSSQAYVWPSQYDHIDDLLYTQFGYIRDGTLGDQVKSCDFGAGVPGIQKAAEWVRTAFHDAVTHDASAKTGGLDASIQYELDRPENLGAALNNTLADLAGAYDIRSTAADLLALSLVMSVDRCADMRVPLRLGRKDATEAGIKGVPEAHTGLETTRKRFATASISGVDMITLIACGHSIGGVHSVDHPEIVSGPVSPENKASFDTTKGVLDNQVVVEYLNNSTTNPLVRNANDTLNSDKRIFASDDNETMRKLADPAYFKSQCEGAFTRMLDLVPGDVTLTEPLQPAEIRPYIAKYEINDDDGVDLNVRVRVRITEGTGRDPASLTASIIPITRNGTLGEEINGRMATMGGGTSFGYQKENFQWFEVFQSFNASDVFDSFKIRVNGEIYDNGATGGYPINGDVLYQRAQTCVTFNSNDTTDITIVAAVSKTLLAGGAAPQIRVVKKVPTQGMVIPKLNPVVLPMQRTSQETAGYVYYTVTTNLNQQSSPTTFDILVGDSKVEYISTGTSNTCTNSA

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAGTAATCTCGCAATTGGTCTTGCGCTGTTTGCGCCCAGTTCTCAGGCATATGTCTGGCCTAGCCAGTACGACCACATAGACGACCTGTTATATACACAATTCGGCTACATCAGA
GATGGCACTCTGGGTGATC
GTACGCATTATCTTTTCTGTATCCATGGTCTAACAGACAACTTACATCCAGACAGAAGTTAAGTCATGCGATTTTGGCGCCGGTGTACCTGGTATACAAAA
GGCAGCAGAGTGGGTACGAACCGCCTTTCACGATGCTGTGACACACGATGCCTCTGCGAAAACCGGAGGACTGGACGCCTCAATCCAATATGAGCTTGACCGACCAGAGAACCTTGGCGC
TGCACTCAACAACACATTAGCGGACCTGGCTGGCGCCTACGATATCCGCAGTACGGCAGCAGACCTTCTCGCATTGTCTCTAGTCATGTCAGTGGATCGTTGTGCGGATATGCGCGTACC
ACTAAGGCTGGGCCGGAAAGATGCGACAGAGGCCGGAATCAAGGGAGTACCTGAGGCCCACACAGGCCTCGAAACCACCCGCAAGCGGTTCGCAACTGCTAGTATCAGTGGAG
GTAAGCC
CGCCGTCGTATGTCATCTCATAGATTGACTGAAAGCTGACTTTCCCTAGTCGACATGATCACTTTGATTGCTTGTGGGCACAGTATCGGTGGCGTTCACTCCGTCGACCACCCTGAAATC
GTCTCTGGTCCAGTTAGCCCAGAGAACAAAGCCAGTTTTGACACCACCAAAGGCGTTCTAGACAACCAAGTGGTGGTGGAATATCTTAACAACTCCACCACAAATCCACTGGTCCGTAAC
GCCAACGATACATTGAACTCCGATAAGCGTATCTTCGCTTCTGATGACAACGAAACCATGAGAAAGCTCGCAGATCCAGCTTATTTCAAGTCGCAGTGTGAGGGTGCCTTTACACGCATG
CTAGATCTCGTCCCGGGAGACGTCACGCTCACCGAGCCCCTGCAGCCAGCAGAAATCCGGCCATACATCGCAAAATATGAAATCAACGACGACGACGGTGTTGACCTCAACGTCCGCGTC
CGCGTCCGTATCACAGAAGGTACCGGTCGTGACCCCGCATCTCTCACCGCATCTATCATTCCCATTACGCGCAATGGCACTCTAGGGGAGGAGATCAATGGCAGGATGGCCACAATGGGC
GGTGGAACATCGTTCGGCTACCAGAAGGAGAACTTTCAATGGTTCGAAGTCTTCCAATCGTTCAACGCCAGTGACGTTTTTGACTCGTTTAAAATCCGTGTCAACGGTGAAATCTACGAC
AACGGCGCAACAGGTGGCTACCCTATCAATGGCGATGTGTTGTACCAAAGGGCACAGACGTGCGTCACATTTAATTCAAACGACACCACCGATATAACCATTGTTGCTGCTGTCTCAAAG
ACGCTGTTGGCCGGCGGAGCTGCCCCACAAATCCGCGTGGTGAAGAAGGTACCAACTCAAGGAATGGTTATTCCTAAGTTGAACCCAGTCGTGCTTCCCATGCAGCGTACCTCTCAAGAG
ACAGCTGGATACGTGTACTACACTGTTACAACGAATCTCAACCAGCAGAGCTCACCTACTACCTTTGATATTTTGGTTGGCGATTCAAAGGTCGAGTACATTTCTACAGGTACCTCGAAC
ACCTGCACAAATTCAGCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAGTAATCTCGCAATTGGTCTTGCGCTGTTTGCGCCCAGTTCTCAGGCATATGTCTGGCCTAGCCAGTACGACCACATAGACGACCTGTTATATACACAATTCGGCTACATCAGA
GATGGCACTCTGGGTGATC
AAGTTAAGTCATGCGATTTTGGCGCCGGTGTACCTGGTATACAAAAGGCAGCAGAGTGGGTACGAACCGCCTTTCACGATGCTGTGACACACGATGCCTCT
GCGAAAACCGGAGGACTGGACGCCTCAATCCAATATGAGCTTGACCGACCAGAGAACCTTGGCGCTGCACTCAACAACACATTAGCGGACCTGGCTGGCGCCTACGATATCCGCAGTACG
GCAGCAGACCTTCTCGCATTGTCTCTAGTCATGTCAGTGGATCGTTGTGCGGATATGCGCGTACCACTAAGGCTGGGCCGGAAAGATGCGACAGAGGCCGGAATCAAGGGAGTACCTGAG
GCCCACACAGGCCTCGAAACCACCCGCAAGCGGTTCGCAACTGCTAGTATCAGTGGAG
TCGACATGATCACTTTGATTGCTTGTGGGCACAGTATCGGTGGCGTTCACTCCGTCGACCAC
CCTGAAATCGTCTCTGGTCCAGTTAGCCCAGAGAACAAAGCCAGTTTTGACACCACCAAAGGCGTTCTAGACAACCAAGTGGTGGTGGAATATCTTAACAACTCCACCACAAATCCACTG
GTCCGTAACGCCAACGATACATTGAACTCCGATAAGCGTATCTTCGCTTCTGATGACAACGAAACCATGAGAAAGCTCGCAGATCCAGCTTATTTCAAGTCGCAGTGTGAGGGTGCCTTT
ACACGCATGCTAGATCTCGTCCCGGGAGACGTCACGCTCACCGAGCCCCTGCAGCCAGCAGAAATCCGGCCATACATCGCAAAATATGAAATCAACGACGACGACGGTGTTGACCTCAAC
GTCCGCGTCCGCGTCCGTATCACAGAAGGTACCGGTCGTGACCCCGCATCTCTCACCGCATCTATCATTCCCATTACGCGCAATGGCACTCTAGGGGAGGAGATCAATGGCAGGATGGCC
ACAATGGGCGGTGGAACATCGTTCGGCTACCAGAAGGAGAACTTTCAATGGTTCGAAGTCTTCCAATCGTTCAACGCCAGTGACGTTTTTGACTCGTTTAAAATCCGTGTCAACGGTGAA
ATCTACGACAACGGCGCAACAGGTGGCTACCCTATCAATGGCGATGTGTTGTACCAAAGGGCACAGACGTGCGTCACATTTAATTCAAACGACACCACCGATATAACCATTGTTGCTGCT
GTCTCAAAGACGCTGTTGGCCGGCGGAGCTGCCCCACAAATCCGCGTGGTGAAGAAGGTACCAACTCAAGGAATGGTTATTCCTAAGTTGAACCCAGTCGTGCTTCCCATGCAGCGTACC
TCTCAAGAGACAGCTGGATACGTGTACTACACTGTTACAACGAATCTCAACCAGCAGAGCTCACCTACTACCTTTGATATTTTGGTTGGCGATTCAAAGGTCGAGTACATTTCTACAGGT
ACCTCGAACACCTGCACAAATTCAGCATAG

Retrieve as FASTA