Entry information : SturAPx-CcP01
Entry ID 11697
Creation 2013-04-08 (Christophe Dunand)
Last sequence changes 2013-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SturAPx-CcP01
Name SturAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Setosphaeria
Organism Setosphaeria turcica    [TaxId: 93612 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SturAPx-CcP01
start..stop
S start..stop
AalteAPx-CcP01 676 0 7..488 9..525
ClunAPx-CcP01 672 0 20..488 20..529
PtritAPx-CcP01 665 0 11..488 9..526
COsaAPx-CcP01 656 0 1..488 1..530
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1280471..1280861 391 N° 2 1280178..1280410 233 N° 3 1279977..1280123 147 N° 4 1279164..1279859 696
complement(join(1279164..1279859,1279977..1280123,1280178..1280410,1280471..1280 861))


exon

Literature and cross-references SturAPx-CcP01
DNA ref. JGI genome:   scaffold_4 (1280861..1279164)
Cluster/Prediction ref. JGI gene:   172594
Protein sequence: SturAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   489 (465)
PWM (Da):   %s   51603.02 (48818.5)  
PI (pH):   %s   5.01 (4.82) Peptide Signal:   %s   cut: 24 range:24-488
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLSPRLLFPLALIAFHVNAALYHPTPQQSLLEHILVDNWGAYASNFSSAITPCDRYVTQTGTAALTSGRTTAAQWMRVLFHDFITADVAKGTGGVDASIGFETAREENKGSAFNDSFTFWRPFVNEYVSMADLVALGTVMSNNLCGGKDMAYRPGRVDATEAGITTGVPAPETSLEETLEFFERAGFGKKDAIGLTACGHTMGSVHHGGFPEVVDESFVTPNNTNGGSNFDTTRSIFDPRVVAEYLNGTGSRGGPLLMGRAIETVPNGVQLGDPITAMPVKPINVTYDFDEDKKLVLSGKIRILTPGNASPPQTLSLHIGQAEETLVAEAETGTSVFGRENANYGITTYFPFVLSGPVIRNATVLTVRGPTISEQTFDISSQVFIVPSATTMQGKTLSVTVAVAKPYSCDTLSVRTAAPLTQPGTLAPKMSQRTADLGKANGSVDVYTLCQGVATISGLPTGLVTVEAAVGKKVVDTLLVDGGTAGW*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTTTCTCCCCGATTACTTTTTCCCCTGGCTCTCATCGCCTTCCATGTGAATGCAGCACTGTATCATCCCACGCCACAGCAGTCTCTTCTCGAGCACATTCTCGTCGATAATTGG
GGTGCATACGCGTCTAACTTCTCGTCGGCAATCACGCCCTGCGATCGCTATGTCACGCAAACAGGGACTGCAGCACTGACGAGCGGGCGTACAACAGCTGCGCAATGGATGCGCGTTCTC
TTCCACGACTTTATCACTGCCGATGTGGCAAAAGGAACTGGAGGTGTCGATGCGAGCATCGGCTTCGAGACTGCACGAGAAGAAAATAAAGGGAGTGCGTTCAATGATAGTTTTACATTC
TGGAGGCCGTTTGTAAATGAATATGTGAGCA
GTAAGTAGCTTTCGATAACAGCAAGTTGGAAAGACATATATCTGACTGAGCTCTCTGCAGTGGCCGACCTCGTTGCGCTGGGTACGGTC
ATGTCGAATAATCTCTGCGGCGGCAAAGACATGGCCTACCGACCTGGACGCGTCGACGCCACTGAAGCAGGAATCACGACTGGAGTGCCCGCCCCAGAAACCAGTTTAGAAGAAACACTG
GAGTTCTTCGAGCGCGCTGGGTTCGGAAAGAAAGATGCCATTGGCCTTACAGCCTGTGGCCATACCATGGGCTCTGTTCATCAT
GTGGGTTATTACAACCTGGCGCTTTCTTTTAGTACT
GACTTTGCGTTTTCCCAGGGCGGCTTCCCCGAAGTCGTAGATGAGTCCTTTGTTACACCCAACAATACCAATGGTGGCAGCAACTTTGATACCACACGCAGCATCTTCGATCCCAGAGTC
GTTGCCGAGTACCTCAACGGCACAGGAAGCCGTGGTGGCCCCCTC
GTCACATCTTACAATGAAACAATGAACTCGGATCTGCGGCTCTATGAAAGCGACAACAACGATACGATGCGTGCC
CTGTTTGCGTCCGGAGCAGGTTTCCTCGACACTTGCACGTAGCTCATGGGCCGCGCGATTGAAACCGTGCCAAATGGTGTGCAACTGGGCGATCCGATTACCGCGATGCCCGTGAAGCCC
ATAAATGTGACGTACGACTTTGACGAGGACAAGAAGTTAGTACTTTCAGGAAAAATCAGGATTCTCACGCCAGGAAATGCTTCGCCGCCTCAAACCCTCAGCCTTCACATTGGCCAAGCA
GAGGAAACACTTGTCGCGGAAGCTGAGACCGGCACTTCGGTCTTTGGTCGTGAAAACGCCAATTACGGGATCACTACATATTTTCCGTTTGTGCTCTCAGGACCGGTAATTCGGAACGCT
ACGGTCTTGACCGTCAGGGGCCCTACGATATCCGAGCAGACTTTTGATATCAGCAGTCAAGTGTTCATCGTACCAAGTGCAACGACGATGCAAGGAAAAACGCTAAGTGTCACGGTTGCT
GTGGCTAAGCCATATTCATGCGATACTCTTTCAGTGCGCACAGCAGCGCCACTTACCCAGCCAGGAACACTGGCGCCGAAGATGAGTCAGAGGACTGCGGATTTGGGAAAAGCTAACGGA
TCGGTTGATGTGTATACGCTCTGTCAGGGTGTTGCTACAATAAGTGGCTTACCCACGGGTCTAGTGACTGTGGAAGCGGCAGTCGGAAAGAAAGTGGTGGATACATTGTTGGTCGACGGT
GGCACGGCAGGCTGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTTTCTCCCCGATTACTTTTTCCCCTGGCTCTCATCGCCTTCCATGTGAATGCAGCACTGTATCATCCCACGCCACAGCAGTCTCTTCTCGAGCACATTCTCGTCGATAATTGG
GGTGCATACGCGTCTAACTTCTCGTCGGCAATCACGCCCTGCGATCGCTATGTCACGCAAACAGGGACTGCAGCACTGACGAGCGGGCGTACAACAGCTGCGCAATGGATGCGCGTTCTC
TTCCACGACTTTATCACTGCCGATGTGGCAAAAGGAACTGGAGGTGTCGATGCGAGCATCGGCTTCGAGACTGCACGAGAAGAAAATAAAGGGAGTGCGTTCAATGATAGTTTTACATTC
TGGAGGCCGTTTGTAAATGAATATGTGAGCA
TGGCCGACCTCGTTGCGCTGGGTACGGTCATGTCGAATAATCTCTGCGGCGGCAAAGACATGGCCTACCGACCTGGACGCGTCGACGCC
ACTGAAGCAGGAATCACGACTGGAGTGCCCGCCCCAGAAACCAGTTTAGAAGAAACACTGGAGTTCTTCGAGCGCGCTGGGTTCGGAAAGAAAGATGCCATTGGCCTTACAGCCTGTGGC
CATACCATGGGCTCTGTTCATCAT
GGCGGCTTCCCCGAAGTCGTAGATGAGTCCTTTGTTACACCCAACAATACCAATGGTGGCAGCAACTTTGATACCACACGCAGCATCTTCGATCCC
AGAGTCGTTGCCGAGTACCTCAACGGCACAGGAAGCCGTGGTGGCCCCCTC
CTCATGGGCCGCGCGATTGAAACCGTGCCAAATGGTGTGCAACTGGGCGATCCGATTACCGCGATGCCC
GTGAAGCCCATAAATGTGACGTACGACTTTGACGAGGACAAGAAGTTAGTACTTTCAGGAAAAATCAGGATTCTCACGCCAGGAAATGCTTCGCCGCCTCAAACCCTCAGCCTTCACATT
GGCCAAGCAGAGGAAACACTTGTCGCGGAAGCTGAGACCGGCACTTCGGTCTTTGGTCGTGAAAACGCCAATTACGGGATCACTACATATTTTCCGTTTGTGCTCTCAGGACCGGTAATT
CGGAACGCTACGGTCTTGACCGTCAGGGGCCCTACGATATCCGAGCAGACTTTTGATATCAGCAGTCAAGTGTTCATCGTACCAAGTGCAACGACGATGCAAGGAAAAACGCTAAGTGTC
ACGGTTGCTGTGGCTAAGCCATATTCATGCGATACTCTTTCAGTGCGCACAGCAGCGCCACTTACCCAGCCAGGAACACTGGCGCCGAAGATGAGTCAGAGGACTGCGGATTTGGGAAAA
GCTAACGGATCGGTTGATGTGTATACGCTCTGTCAGGGTGTTGCTACAATAAGTGGCTTACCCACGGGTCTAGTGACTGTGGAAGCGGCAGTCGGAAAGAAAGTGGTGGATACATTGTTG
GTCGACGGTGGCACGGCAGGCTGGTAA

Retrieve as FASTA