Entry information : SturAPx-CcP02
Entry ID 11698
Creation 2013-04-08 (Christophe Dunand)
Last sequence changes 2013-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SturAPx-CcP02
Name SturAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Setosphaeria
Organism Setosphaeria turcica    [TaxId: 93612 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SturAPx-CcP02
start..stop
S start..stop
ClunAPx-CcP02 884 0 1..527 1..526
COsaAPx-CcP02 771 0 1..527 1..525
CheAPx-CcP02_C4 736 0 1..527 1..510
PnoAPx-CcP01 720 0 1..530 1..531
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68368..68506 139 N° 2 68562..68960 399 N° 3 69017..70071 1055  
join(68368..68506,68562..68960,69017..70071)


exon

Literature and cross-references SturAPx-CcP02
DNA ref. JGI genome:   scaffold_6 (68368..70071)
Cluster/Prediction ref. JGI gene:   180741
Protein sequence: SturAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   531 (512)
PWM (Da):   %s   57101.76 (55185.7)  
PI (pH):   %s   4.99 (4.84) Peptide Signal:   %s   cut: 19 range:19-530
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSHLAISLALLAPASQAYVWPSQYDRIEDLLYLQSGYIRDGSLSDQVATCAFGAGSPGIQKAAEWVRTAFHDTVTHDASTKTGGLDASIQFELDRPENKGAALNNTLSDISSSVDIRTSAADLIALSLVMAVARCGNMRVPLKLGRKDATEAGIKGVPEAHTDLDTTRKRFATASLSEVDMITLIACGHSIGGVHSVDHPEIVSGPVSAANKASFDTTSAALDNKVVVEYLGNTTANPLVRNANDTLNSDKRIFASDDNKTMRKLADTSYFKSQCEDVLGRMLDLVPGDVTLTDPLQPADVRPYILTYGLNANGGVDFSGRIRVRITPSTGRDPNSLTAAIIPITRNGTAGPEIDAPIFTAYLLGQSVGYLDEAFQWFEFSYSMNASETFDSFKIRLNDKIYDNGGTGTYPINGDVLYQQKQSCMSFDSATNQGNLTVTAAVSKTLLQNKAAPQIRLVKRTKVQGYHIDRLEQVVVPMQPANKETAQYAYYTASAPINLESLSTTFDIEVGDSKVEYITAPDIGTCAPL*

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAGCCATCTCGCAATCAGTCTTGCGCTGCTAGCGCCCGCTTCACAGGCATATGTCTGGCCCAGCCAGTACGACCGCATCGAAGACCTTTTGTATCTGCAATCCGGCTACATCAGA
GACGGCTCTCTCTCCGACC
GTGCGTGTCTTCATCTCTGCCTTTAGCCGCCCGCAAAAGACTTACATCCATGCAGAAGTTGCGACATGCGCCTTTGGCGCCGGCTCACCTGGCATACAAAA
GGCTGCCGAATGGGTACGGACTGCCTTCCACGACACTGTAACGCACGATGCTTCCACCAAGACGGGAGGTCTTGATGCTTCGATCCAGTTCGAGCTTGATCGACCCGAAAACAAAGGCGC
TGCCCTGAACAACACATTATCAGACATCTCCTCCTCCGTCGATATTCGCACTTCAGCAGCAGACCTGATAGCCTTATCTCTGGTCATGGCAGTGGCTCGTTGCGGTAATATGCGCGTGCC
GCTAAAGCTGGGCCGGAAGGATGCGACCGAGGCTGGCATCAAGGGAGTCCCTGAGGCCCATACGGATCTCGACACCACGCGCAAGAGATTTGCGACTGCTAGCCTCAGCGAGG
GTAAACT
ACTCTTTGATCTTATCTCAAAAGTGAACAAAACTAACTCGTATTCCCAGTCGACATGATTACATTGATTGCTTGTGGTCACAGTATCGGTGGCGTTCACTCGGTCGATCATCCTGAAATT
GTCTCTGGCCCAGTCAGCGCGGCGAACAAAGCCAGCTTTGATACCACCTCGGCCGCTCTGGACAACAAGGTAGTTGTAGAGTACCTTGGCAATACTACGGCAAACCCCCTGGTCCGCAAC
GCCAACGATACACTGAACTCGGACAAGCGCATCTTCGCCTCGGATGACAACAAGACCATGAGAAAGCTTGCCGATACGTCTTACTTCAAGTCCCAGTGTGAAGACGTGCTTGGTCGCATG
CTGGATCTCGTTCCTGGCGATGTTACGCTCACGGATCCCTTGCAGCCAGCAGACGTCAGGCCATACATCCTCACATATGGCCTCAATGCCAATGGGGGCGTCGACTTCTCCGGCCGTATT
CGTGTTCGCATCACACCAAGCACAGGTCGCGATCCCAACTCGCTCACTGCAGCCATCATCCCCATTACTCGCAATGGCACTGCAGGCCCGGAGATTGATGCTCCCATCTTCACGGCCTAC
CTCCTAGGGCAATCGGTGGGTTACTTAGATGAGGCCTTCCAATGGTTCGAATTCAGTTACTCCATGAACGCCAGCGAGACATTCGACTCGTTCAAAATCCGCCTTAATGACAAAATCTAC
GACAACGGTGGCACAGGCACCTATCCTATCAATGGCGATGTCTTGTATCAGCAGAAGCAGTCGTGCATGTCATTCGATTCAGCTACAAACCAAGGTAACCTTACCGTCACTGCGGCCGTC
TCCAAAACGCTCCTCCAAAACAAGGCCGCGCCACAAATCCGCCTAGTGAAGCGGACAAAGGTCCAAGGATATCATATCGATCGCTTGGAACAGGTCGTCGTCCCTATGCAGCCTGCAAAT
AAGGAGACGGCGCAATATGCATACTACACTGCCTCTGCACCTATTAATTTAGAAAGTCTGTCTACTACCTTTGATATTGAAGTCGGAGATTCAAAGGTAGAGTACATTACCGCACCCGAT
ATTGGCACTTGTGCGCCACTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAGCCATCTCGCAATCAGTCTTGCGCTGCTAGCGCCCGCTTCACAGGCATATGTCTGGCCCAGCCAGTACGACCGCATCGAAGACCTTTTGTATCTGCAATCCGGCTACATCAGA
GACGGCTCTCTCTCCGACC
AAGTTGCGACATGCGCCTTTGGCGCCGGCTCACCTGGCATACAAAAGGCTGCCGAATGGGTACGGACTGCCTTCCACGACACTGTAACGCACGATGCTTCC
ACCAAGACGGGAGGTCTTGATGCTTCGATCCAGTTCGAGCTTGATCGACCCGAAAACAAAGGCGCTGCCCTGAACAACACATTATCAGACATCTCCTCCTCCGTCGATATTCGCACTTCA
GCAGCAGACCTGATAGCCTTATCTCTGGTCATGGCAGTGGCTCGTTGCGGTAATATGCGCGTGCCGCTAAAGCTGGGCCGGAAGGATGCGACCGAGGCTGGCATCAAGGGAGTCCCTGAG
GCCCATACGGATCTCGACACCACGCGCAAGAGATTTGCGACTGCTAGCCTCAGCGAGG
TCGACATGATTACATTGATTGCTTGTGGTCACAGTATCGGTGGCGTTCACTCGGTCGATCAT
CCTGAAATTGTCTCTGGCCCAGTCAGCGCGGCGAACAAAGCCAGCTTTGATACCACCTCGGCCGCTCTGGACAACAAGGTAGTTGTAGAGTACCTTGGCAATACTACGGCAAACCCCCTG
GTCCGCAACGCCAACGATACACTGAACTCGGACAAGCGCATCTTCGCCTCGGATGACAACAAGACCATGAGAAAGCTTGCCGATACGTCTTACTTCAAGTCCCAGTGTGAAGACGTGCTT
GGTCGCATGCTGGATCTCGTTCCTGGCGATGTTACGCTCACGGATCCCTTGCAGCCAGCAGACGTCAGGCCATACATCCTCACATATGGCCTCAATGCCAATGGGGGCGTCGACTTCTCC
GGCCGTATTCGTGTTCGCATCACACCAAGCACAGGTCGCGATCCCAACTCGCTCACTGCAGCCATCATCCCCATTACTCGCAATGGCACTGCAGGCCCGGAGATTGATGCTCCCATCTTC
ACGGCCTACCTCCTAGGGCAATCGGTGGGTTACTTAGATGAGGCCTTCCAATGGTTCGAATTCAGTTACTCCATGAACGCCAGCGAGACATTCGACTCGTTCAAAATCCGCCTTAATGAC
AAAATCTACGACAACGGTGGCACAGGCACCTATCCTATCAATGGCGATGTCTTGTATCAGCAGAAGCAGTCGTGCATGTCATTCGATTCAGCTACAAACCAAGGTAACCTTACCGTCACT
GCGGCCGTCTCCAAAACGCTCCTCCAAAACAAGGCCGCGCCACAAATCCGCCTAGTGAAGCGGACAAAGGTCCAAGGATATCATATCGATCGCTTGGAACAGGTCGTCGTCCCTATGCAG
CCTGCAAATAAGGAGACGGCGCAATATGCATACTACACTGCCTCTGCACCTATTAATTTAGAAAGTCTGTCTACTACCTTTGATATTGAAGTCGGAGATTCAAAGGTAGAGTACATTACC
GCACCCGATATTGGCACTTGTGCGCCACTATAG

Retrieve as FASTA