Entry information : PtritCcP
Entry ID 11699
Creation 2013-04-08 (Christophe Dunand)
Last sequence changes 2013-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PtritCcP
Name PtritCcP
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora tritici-repentis    [TaxId: 45151 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtritCcP
start..stop
S start..stop
PterCcP01 767 0 1..374 1..374
AalteCcP01 731 0 1..374 1..374
AbraCcP 716 0 1..374 1..373
CheCcP_C4 708 0 1..374 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2270856..2271268 413 N° 2 2271326..2272037 712  
join(2270856..2271268,2271326..2272037)


exon

Literature and cross-references PtritCcP
DNA ref. JGI genome:   supercontig_1.3 (2270856..2272037)
Cluster/Prediction ref. JGI gene:   149849
Protein sequence: PtritCcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   374
PWM (Da):   %s   42017.72  
PI (pH):   %s   8.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASRNFSRALRTAAPSFRTTSTRSSARFVAPAQNAFRTQRRGYASKEDGPDKHEGNPTGLAWGAGALLVGAGVYSLYTYKPELFGQTNTKRIFTPRFEDYQKVYDHIAKLLQDHDEYDDGSYGPVLLRLAWHASGTYDKMTNTGGSNGATMRFAPEGDHGANAGLKAARDFLEPVKEAFPWITYSDLWILAGVCAIQEMQGPKIPYRAGRTDRDVSFCTPDGRLPDASKDRSHIRAIFGRMGFDDRAMVALSGAHALGRCHTDRSGYDGPWTFSPTTLTNDYFKLLLEEKWQYKKWNGPKQFEDVKTKSLMMLPTDMELVKDKNFKKYTDLYAKDNDAFFKDFSEAVCTLFELGVPFQQPEDQRYVFKSSFD

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCTCGAAACTTTTCTCGCGCCCTGCGTACCGCTGCACCCTCGTTCCGCACCACGTCGACTCGCTCGTCTGCCCGCTTCGTCGCTCCCGCACAAAACGCTTTCCGTACC
CAGCGACGCGGATATGCTTCCAAGGAGGATGGCCCTGACAAGCATGAGGGTAACCCCACTGGTCTAGCGTGGGGTGCTGGTGCTCTCCTTGTTGGTGCTGGTGTATACAGCTTGTACACG
TACAAGCCTGAGTTGTTCGGTCAGACCAATACCAAGAGAATCTTCACCCCACGCTTCGAGGACTACCAGAAGGTCTATGATCACATTGCAAAGCTGCTGCAGGATCACGACGAGTATGAT
GACGGTAGCTACGGACCCGTGTTGCTTCGTCTGGCATGGCACGCTTCTGGAAC
GTGAGTACACTACTGATATCTCTCTGTGTAATCGAATCAAAAACTAACATACCATAGCTACGACAAG
ATGACCAACACTGGCGGTTCCAACGGCGCCACCATGCGCTTCGCCCCCGAAGGAGATCACGGCGCCAACGCTGGTCTAAAGGCTGCCCGCGATTTCCTCGAGCCCGTCAAGGAGGCCTTC
CCCTGGATCACATACTCTGATCTCTGGATCCTCGCCGGTGTCTGCGCCATCCAAGAGATGCAAGGCCCCAAGATCCCCTACCGCGCCGGCCGCACCGACCGCGACGTATCCTTCTGCACA
CCCGACGGCCGTCTTCCAGACGCGAGCAAGGACCGCAGCCACATCCGCGCCATCTTCGGCCGCATGGGCTTTGATGACCGCGCCATGGTCGCTCTATCTGGTGCCCACGCTCTGGGCCGC
TGCCACACCGACCGTTCTGGCTACGACGGCCCCTGGACTTTCTCGCCTACTACCCTCACCAACGACTACTTCAAGTTGCTGCTCGAGGAAAAGTGGCAGTACAAGAAGTGGAATGGTCCC
AAGCAGTTCGAGGACGTCAAGACTAAGAGCCTCATGATGCTGCCCACGGATATGGAGCTTGTCAAGGACAAGAACTTTAAGAAGTACACGGATCTGTATGCCAAGGACAATGATGCTTTC
TTCAAGGACTTTTCAGAGGCTGTGTGCACCCTGTTTGAACTCGGTGTGCCATTCCAGCAGCCAGAGGACCAGCGTTACGTCTTCAAGAGCTCTTTTGATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCTCGAAACTTTTCTCGCGCCCTGCGTACCGCTGCACCCTCGTTCCGCACCACGTCGACTCGCTCGTCTGCCCGCTTCGTCGCTCCCGCACAAAACGCTTTCCGTACC
CAGCGACGCGGATATGCTTCCAAGGAGGATGGCCCTGACAAGCATGAGGGTAACCCCACTGGTCTAGCGTGGGGTGCTGGTGCTCTCCTTGTTGGTGCTGGTGTATACAGCTTGTACACG
TACAAGCCTGAGTTGTTCGGTCAGACCAATACCAAGAGAATCTTCACCCCACGCTTCGAGGACTACCAGAAGGTCTATGATCACATTGCAAAGCTGCTGCAGGATCACGACGAGTATGAT
GACGGTAGCTACGGACCCGTGTTGCTTCGTCTGGCATGGCACGCTTCTGGAAC
CTACGACAAGATGACCAACACTGGCGGTTCCAACGGCGCCACCATGCGCTTCGCCCCCGAAGGAGAT
CACGGCGCCAACGCTGGTCTAAAGGCTGCCCGCGATTTCCTCGAGCCCGTCAAGGAGGCCTTCCCCTGGATCACATACTCTGATCTCTGGATCCTCGCCGGTGTCTGCGCCATCCAAGAG
ATGCAAGGCCCCAAGATCCCCTACCGCGCCGGCCGCACCGACCGCGACGTATCCTTCTGCACACCCGACGGCCGTCTTCCAGACGCGAGCAAGGACCGCAGCCACATCCGCGCCATCTTC
GGCCGCATGGGCTTTGATGACCGCGCCATGGTCGCTCTATCTGGTGCCCACGCTCTGGGCCGCTGCCACACCGACCGTTCTGGCTACGACGGCCCCTGGACTTTCTCGCCTACTACCCTC
ACCAACGACTACTTCAAGTTGCTGCTCGAGGAAAAGTGGCAGTACAAGAAGTGGAATGGTCCCAAGCAGTTCGAGGACGTCAAGACTAAGAGCCTCATGATGCTGCCCACGGATATGGAG
CTTGTCAAGGACAAGAACTTTAAGAAGTACACGGATCTGTATGCCAAGGACAATGATGCTTTCTTCAAGGACTTTTCAGAGGCTGTGTGCACCCTGTTTGAACTCGGTGTGCCATTCCAG
CAGCCAGAGGACCAGCGTTACGTCTTCAAGAGCTCTTTTGATTAA

Retrieve as FASTA