Entry information : BdotAPx-CcP01 (BdotHyBpox1)
Entry ID 11700
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-12-29 (Marcel Zamocky)
Peroxidase information: BdotAPx-CcP01 (BdotHyBpox1)
Name (synonym) BdotAPx-CcP01 (BdotHyBpox1)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Botryosphaeria
Organism Botryosphaeria dothidea    [TaxId: 55169 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdotAPx-CcP01
start..stop
S start..stop
BparvAPx-CcP 676 0 1..497 1..496
GgrAPx-CcP01 581 0 2..535 7..543
CfioAPx-CcP02_PJ7 580 0 6..538 7..537
CfioAPx-CcP02_MH18 578 0 20..538 5..521
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12720..12861 142 N° 2 12917..14397 1481  
join(12720..12861,12917..14397)


exon

Literature and cross-references BdotAPx-CcP01 (BdotHyBpox1)
DNA ref. JGI genome:   NODE_3124_length_196523_cov_63.292267 (12720..14397)
Cluster/Prediction ref. JGI gene:   8189
Protein sequence: BdotAPx-CcP01 (BdotHyBpox1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   540 (521)
PWM (Da):   %s   56786.84 (54949.8)  
PI (pH):   %s   4.38 (4.33) Peptide Signal:   %s   cut: 20 range:20-540
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTKLAALAVATAPQALAGYVWPSPHDFLEDLLAMQQGYIRMGFTDLVVPCGHGGNRPGVNNAAQWIRTGFHDFATHDKAAGTGGLDASLLYEVDRPENEGSAFNDTFADMSDFLTPRSSAADLIALAVVASVASCGGSKIPLRAGRIDAKAAGPAGVPKPDDSLESTIDAFARTGFNMSDMIALVACGHTVGGVHSVDFPDITGGEEDVLNVPQFDSTGTAFDTAVVDEYLDSNGANPLVFGANDTTNSDKRVFGADGNSTMNRLKDRDTFQATCASLFERMIDTVPSTVTLSEPIELVDVKPYIDRLELSANASALAFEGRVRVRTSASTGRDNEGISIALDVVDNANTSKLVQAARARARGGTSTGFYNEEFTWFEFATELDAKDGIKAFDVQLTTEKTGAVETFDNAGTGGFPSNDNLLYAQSKSCIDATVKGGNMTVTIGATVREDADKAGEAPMIKLAHKVQQQGVMLPRLAVEGVAMKKSNTSQGGYVFYSVDIPIEAAGWSTKFDVVLPTTDGEIVSGPHGTNDLSACSDV

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCCACCAAGCTCGCAGCCCTCGCTGTTGCAACGGCACCCCAGGCCCTGGCAGGATATGTGTGGCCATCTCCACATGACTTTCTGGAGGACCTGTTGGCCATGCAGCAAGGCTAC
ATTCGCATGGGATTTACCGATT
GTACGTCGCCGCGCCGCTCTGCTTCTTTATCCCTGCTAATGCGTTCTTCCAAAAGTGGTTGTACCCTGTGGCCATGGAGGCAACAGACCCGGGGTGAA
TAACGCTGCGCAATGGATCCGGACCGGTTTCCACGACTTCGCCACACACGACAAGGCTGCCGGCACCGGTGGACTCGATGCTTCTCTCCTGTACGAAGTAGACCGTCCCGAGAACGAAGG
GTCGGCCTTCAACGACACCTTTGCCGACATGAGCGATTTTCTCACTCCCCGATCGAGCGCCGCCGATCTGATAGCGCTGGCCGTAGTCGCATCGGTCGCATCTTGTGGCGGCTCCAAGAT
CCCCCTGCGAGCGGGCCGAATTGATGCTAAGGCAGCCGGACCGGCCGGTGTGCCCAAGCCAGACGATTCCCTGGAGAGCACAATCGATGCATTTGCGCGGACCGGATTTAACATGAGCGA
CATGATCGCCCTGGTCGCCTGCGGGCACACCGTCGGCGGAGTCCACAGCGTAGACTTTCCCGATATCACCGGCGGTGAGGAGGACGTATTGAACGTGCCGCAGTTCGACAGCACAGGGAC
TGCATTCGACACGGCTGTGGTGGACGAGTATTTGGACAGCAACGGCGCCAACCCGTTGGTCTTCGGGGCGAACGACACCACGAACTCGGATAAGCGTGTCTTCGGTGCCGATGGCAACAG
CACCATGAACAGGCTCAAGGACCGCGACACGTTCCAGGCAACCTGCGCAAGCCTCTTCGAGCGTATGATCGACACTGTTCCCTCAACTGTGACTCTCAGCGAACCCATCGAGCTGGTTGA
CGTGAAACCCTACATCGATAGGCTGGAACTCAGTGCCAATGCTTCAGCACTGGCTTTCGAAGGCCGCGTCCGTGTCCGTACCTCCGCCAGCACCGGCCGGGACAACGAAGGCATCAGCAT
TGCCCTGGATGTGGTCGACAACGCTAACACAAGCAAGCTTGTGCAAGCTGCTCGTGCACGAGCCCGAGGTGGTACATCAACTGGCTTCTATAACGAGGAGTTCACCTGGTTCGAGTTCGC
CACGGAGCTGGATGCCAAAGACGGTATCAAAGCCTTCGATGTGCAGCTGACCACGGAGAAGACTGGCGCGGTGGAGACTTTCGATAATGCCGGTACAGGCGGATTTCCGAGCAATGATAA
CCTGCTGTACGCGCAATCGAAGTCGTGCATTGATGCGACAGTAAAGGGCGGTAACATGACAGTTACTATTGGAGCAACGGTGCGGGAGGATGCGGATAAGGCAGGCGAGGCTCCTATGAT
CAAGCTGGCACACAAGGTCCAACAACAGGGGGTCATGTTGCCAAGGCTTGCCGTTGAGGGAGTGGCTATGAAGAAGTCGAACACTTCGCAAGGTGGATACGTGTTCTACTCGGTGGACAT
CCCGATTGAAGCTGCTGGTTGGAGTACGAAGTTCGATGTTGTGCTTCCGACGACGGATGGGGAGATTGTCTCGGGCCCGCATGGGACTAATGATTTGAGCGCATGTTCGGACGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCCACCAAGCTCGCAGCCCTCGCTGTTGCAACGGCACCCCAGGCCCTGGCAGGATATGTGTGGCCATCTCCACATGACTTTCTGGAGGACCTGTTGGCCATGCAGCAAGGCTAC
ATTCGCATGGGATTTACCGATT
TGGTTGTACCCTGTGGCCATGGAGGCAACAGACCCGGGGTGAATAACGCTGCGCAATGGATCCGGACCGGTTTCCACGACTTCGCCACACACGACAAG
GCTGCCGGCACCGGTGGACTCGATGCTTCTCTCCTGTACGAAGTAGACCGTCCCGAGAACGAAGGGTCGGCCTTCAACGACACCTTTGCCGACATGAGCGATTTTCTCACTCCCCGATCG
AGCGCCGCCGATCTGATAGCGCTGGCCGTAGTCGCATCGGTCGCATCTTGTGGCGGCTCCAAGATCCCCCTGCGAGCGGGCCGAATTGATGCTAAGGCAGCCGGACCGGCCGGTGTGCCC
AAGCCAGACGATTCCCTGGAGAGCACAATCGATGCATTTGCGCGGACCGGATTTAACATGAGCGACATGATCGCCCTGGTCGCCTGCGGGCACACCGTCGGCGGAGTCCACAGCGTAGAC
TTTCCCGATATCACCGGCGGTGAGGAGGACGTATTGAACGTGCCGCAGTTCGACAGCACAGGGACTGCATTCGACACGGCTGTGGTGGACGAGTATTTGGACAGCAACGGCGCCAACCCG
TTGGTCTTCGGGGCGAACGACACCACGAACTCGGATAAGCGTGTCTTCGGTGCCGATGGCAACAGCACCATGAACAGGCTCAAGGACCGCGACACGTTCCAGGCAACCTGCGCAAGCCTC
TTCGAGCGTATGATCGACACTGTTCCCTCAACTGTGACTCTCAGCGAACCCATCGAGCTGGTTGACGTGAAACCCTACATCGATAGGCTGGAACTCAGTGCCAATGCTTCAGCACTGGCT
TTCGAAGGCCGCGTCCGTGTCCGTACCTCCGCCAGCACCGGCCGGGACAACGAAGGCATCAGCATTGCCCTGGATGTGGTCGACAACGCTAACACAAGCAAGCTTGTGCAAGCTGCTCGT
GCACGAGCCCGAGGTGGTACATCAACTGGCTTCTATAACGAGGAGTTCACCTGGTTCGAGTTCGCCACGGAGCTGGATGCCAAAGACGGTATCAAAGCCTTCGATGTGCAGCTGACCACG
GAGAAGACTGGCGCGGTGGAGACTTTCGATAATGCCGGTACAGGCGGATTTCCGAGCAATGATAACCTGCTGTACGCGCAATCGAAGTCGTGCATTGATGCGACAGTAAAGGGCGGTAAC
ATGACAGTTACTATTGGAGCAACGGTGCGGGAGGATGCGGATAAGGCAGGCGAGGCTCCTATGATCAAGCTGGCACACAAGGTCCAACAACAGGGGGTCATGTTGCCAAGGCTTGCCGTT
GAGGGAGTGGCTATGAAGAAGTCGAACACTTCGCAAGGTGGATACGTGTTCTACTCGGTGGACATCCCGATTGAAGCTGCTGGTTGGAGTACGAAGTTCGATGTTGTGCTTCCGACGACG
GATGGGGAGATTGTCTCGGGCCCGCATGGGACTAATGATTTGAGCGCATGTTCGGACGTTTGA

Retrieve as FASTA