Entry information : BdotCcP01
Entry ID 11702
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-10-15 (Catherine Mathe (Scipio))
Peroxidase information: BdotCcP01
Name BdotCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Botryosphaeria
Organism Botryosphaeria dothidea    [TaxId: 55169 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdotCcP01
start..stop
S start..stop
GsteCcP02 575 0 1..371 1..372
HpulCcP02 575 0 1..371 1..368
LpaluCcP02 566 0 1..371 1..372
CgeoCcP01 559 0 1..371 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 80875..81278 404 N° 2 80017..80728 712  
complement(join(80017..80728,80875..81278))


exon

Literature and cross-references BdotCcP01
DNA ref. JGI genome:   NODE_4528_length_145090_cov_63.679951 (81278..80017)
Cluster/Prediction ref. JGI gene:   10213
Protein sequence: BdotCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371
PWM (Da):   %s   41029.32  
PI (pH):   %s   9.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAARSVFTRNALLRSASASVRTHAARSSRFAVPAQAFRQQSRRGYSSETGSKSNGPNPAVWIGALAVLGGAGYYAYSSGTSAQVSSKEPFTPKFEDYQKVYDVIAKALEEHDDYDDGSYGPVLLRLAWHASGTYDKETGTGGSNGATMRFAPESDHGANAGLKAARDFLEPIKQQFPWITYSDLWTLGGVAAVQEMQGPKIPWRPGRSDRDVSFCTPDGRLPDASKESNHLRAIFGRMGWNDQEIVALSGAHALGRCHTDRSGFDGPWTFSPTTLTNDYFKLLLDEKWQWRKWNGPKQLQDAKTKSLMMLPTDYALVQDKKFKPWVEAYAKDQDAFFKDFSSVVTRLFELGVPFQTGEDARFTFKSSFD

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCGCCGCCAGGTCCGTTTTCACCCGCAATGCGCTTCTGCGCTCCGCCTCGGCCTCCGTCAGAACACATGCTGCCCGCTCTTCTCGCTTCGCCGTTCCCGCCCAAGCTTTCCGC
CAGCAATCTCGCCGCGGCTACTCTTCCGAGACTGGTTCCAAGTCTAACGGCCCCAACCCTGCTGTCTGGATCGGTGCTCTTGCTGTTCTCGGTGGCGCCGGATACTACGCATACAGCTCG
GGTACCAGCGCACAGGTCTCCTCCAAGGAGCCCTTCACTCCCAAGTTCGAGGACTACCAGAAGGTGTACGATGTCATTGCGAAGGCTCTGGAGGAGCACGACGACTATGATGATGGCAGC
TATGGTCCTGTCTTGTTGAGATTGGCGTGGCACGCCAGCGGAAC
GTGAGTGACCTCGTCCAACACTTCCCCCTCCCACCCCACCCCACCCCCTACCAGTGAACACTCTCCTGCTTGCGCC
TGGAAGCGTTGCTGCTGAAGCGGATGGGGAGAAGAGATGTATGGACGTTGGAAATCTGACACTCTCGCAGTTACGATAAGGAAACTGGCACTGGCGGCTCCAATGGCGCAACCATGCGCT
TCGCACCCGAGTCCGACCACGGCGCCAATGCTGGCCTGAAGGCGGCCCGCGACTTCCTCGAGCCCATCAAGCAGCAGTTCCCGTGGATTACCTACTCGGATCTGTGGACGCTAGGAGGCG
TCGCCGCCGTACAGGAGATGCAAGGCCCGAAGATCCCCTGGAGGCCAGGCCGCTCCGACCGTGATGTGTCATTTTGTACGCCAGATGGAAGGCTGCCCGATGCTAGTAAAGAGTCTAATC
ATCTGAGGGCCATCTTCGGTCGCATGGGCTGGAATGACCAAGAAATCGTGGCGCTGTCCGGCGCGCACGCACTCGGACGCTGTCACACGGACCGCAGCGGCTTCGACGGCCCCTGGACCT
TCTCGCCGACGACGCTGACCAACGACTATTTCAAGCTGCTGCTCGACGAGAAGTGGCAGTGGAGGAAGTGGAATGGCCCCAAGCAGCTGCAGGACGCCAAGACGAAGAGCTTGATGATGC
TGCCGACCGACTACGCGCTCGTCCAGGACAAGAAGTTCAAGCCGTGGGTCGAGGCGTACGCGAAGGACCAGGATGCGTTCTTCAAGGACTTCTCGAGCGTCGTCACCAGGCTGTTTGAGC
TGGGTGTGCCGTTCCAGACGGGTGAGGATGCGAGGTTTACGTTCAAGAGCAGCTTTGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCGCCGCCAGGTCCGTTTTCACCCGCAATGCGCTTCTGCGCTCCGCCTCGGCCTCCGTCAGAACACATGCTGCCCGCTCTTCTCGCTTCGCCGTTCCCGCCCAAGCTTTCCGC
CAGCAATCTCGCCGCGGCTACTCTTCCGAGACTGGTTCCAAGTCTAACGGCCCCAACCCTGCTGTCTGGATCGGTGCTCTTGCTGTTCTCGGTGGCGCCGGATACTACGCATACAGCTCG
GGTACCAGCGCACAGGTCTCCTCCAAGGAGCCCTTCACTCCCAAGTTCGAGGACTACCAGAAGGTGTACGATGTCATTGCGAAGGCTCTGGAGGAGCACGACGACTATGATGATGGCAGC
TATGGTCCTGTCTTGTTGAGATTGGCGTGGCACGCCAGCGGAAC
TTACGATAAGGAAACTGGCACTGGCGGCTCCAATGGCGCAACCATGCGCTTCGCACCCGAGTCCGACCACGGCGCC
AATGCTGGCCTGAAGGCGGCCCGCGACTTCCTCGAGCCCATCAAGCAGCAGTTCCCGTGGATTACCTACTCGGATCTGTGGACGCTAGGAGGCGTCGCCGCCGTACAGGAGATGCAAGGC
CCGAAGATCCCCTGGAGGCCAGGCCGCTCCGACCGTGATGTGTCATTTTGTACGCCAGATGGAAGGCTGCCCGATGCTAGTAAAGAGTCTAATCATCTGAGGGCCATCTTCGGTCGCATG
GGCTGGAATGACCAAGAAATCGTGGCGCTGTCCGGCGCGCACGCACTCGGACGCTGTCACACGGACCGCAGCGGCTTCGACGGCCCCTGGACCTTCTCGCCGACGACGCTGACCAACGAC
TATTTCAAGCTGCTGCTCGACGAGAAGTGGCAGTGGAGGAAGTGGAATGGCCCCAAGCAGCTGCAGGACGCCAAGACGAAGAGCTTGATGATGCTGCCGACCGACTACGCGCTCGTCCAG
GACAAGAAGTTCAAGCCGTGGGTCGAGGCGTACGCGAAGGACCAGGATGCGTTCTTCAAGGACTTCTCGAGCGTCGTCACCAGGCTGTTTGAGCTGGGTGTGCCGTTCCAGACGGGTGAG
GATGCGAGGTTTACGTTCAAGAGCAGCTTTGACTAA

Retrieve as FASTA