Entry information : BdotAPx-CcP03
Entry ID 11704
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2014-11-26 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information: BdotAPx-CcP03
Name BdotAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Botryosphaeria
Organism Botryosphaeria dothidea    [TaxId: 55169 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdotAPx-CcP03
start..stop
S start..stop
GsteAPx-CcP01 614 0 1..526 1..534
ApruAPx-CcP02 599 0 7..528 4..525
TeqAPx-CcP1 571 0 7..523 5..532
TtoAPx-CcP1_CBS112818 567 0 7..523 5..532
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 506..1639 1134 N° 2 4..456 453  
complement(join(4..456,506..1639))


exon

Literature and cross-references BdotAPx-CcP03
DNA ref. JGI genome:   NODE_1108_length_73967_cov_65.462479 (1639..4)
Cluster/Prediction ref. JGI gene:   722
Protein sequence: BdotAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   529 (505)
PWM (Da):   %s   55238.42 (52802.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.48 (4.39) Peptide Signal:   %s   cut: 25 range:25-529
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARHPCLTLVWVAGAVYNAIGAAAAPTWPSSTDELEDIMVLNTGYRARDFAVPVTPCGFSPEGAGRVQAAEWIRTAFHDMAGGSVYTGIGGLDASIAYETRSLENVGPAFNTTLATYAPYLTSRSSMADLIALGVYTAVRSCGGPIVPIRTGRVDATAAGPQGVPLPQNSLGTFQNQFLRTGFNSTEMIQVVACGHTLGGVHSANNPEIVPVGTAEDEVVKFDTTDAFDNKVVTEYLSNTTKNALVVGPSTSNGRNSDARVFASDKNVTVRALTDPDTFNSVCARMMQKMIEVVPSGVVLTDPISIYDVKPSGLQLTLLGGGESIKLTGDIRVRTTERAASQIESVELVYKGRDGAESSTALSTESSGSASGFDDSFEFYGIFANIPADSGISSFTVRIALTSGETELHDNNGSGFPLKDTVFFQSPQSCLAGTSMTVTAAVLTTQSAPTLNVTTKVPNSRSVLPSLSAATVAMTKGSSVGPYDLYSVTVTLTSAQLDDTRFDVKVGSAIDAFKSSADLGDTCQDLSPA

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGACATCCCTGCCTGACCCTGGTGTGGGTCGCAGGCGCCGTCTACAACGCCATTGGCGCCGCCGCCGCCCCGACATGGCCCTCCTCCACGGACGAATTGGAGGATATCATGGTC
CTCAACACCGGTTACCGCGCCCGCGACTTCGCAGTGCCCGTCACCCCCTGCGGCTTCTCACCCGAAGGCGCCGGACGCGTGCAGGCCGCCGAATGGATACGGACGGCCTTCCACGACATG
GCCGGCGGGAGCGTGTACACTGGAATCGGAGGCCTGGATGCGTCAATAGCCTACGAAACGCGGAGTCTCGAGAACGTTGGCCCGGCGTTCAACACGACACTGGCCACGTACGCGCCGTAT
TTGACGAGCAGGTCCTCGATGGCTGACCTTATTGCCCTGGGTGTCTACACGGCGGTGCGATCTTGCGGAGGGCCAATTGTGCCTATACGGACCGGCAGAGTGGATGCCACGGCAGCAGGG
CCGCAGGGGGTGCCGCTGCCGCAGAACTCACTCGGGACATTCCAGAATCAATTCCTGCGAACGGGCTTCAATAGTACGGAAATGATCCAGGTGGTGGCGTGCGGACACACGTTGGGAGGT
GTACACTCAGCGAACAACCCGGAAATTGTGCCCGTAGGAACAGCGGAAGATGAAGTTGTCAAGTTCGACACAACGGACGCATTTGATAACAAAGTCGTCACTGAGTACCTCTCGAACACT
ACCAAGAACGCCCTTGTGGTGGGCCCTTCTACGAGTAACGGGCGGAACTCAGACGCGCGTGTGTTTGCTTCGGATAAAAATGTGACTGTCAGGGCTCTGACGGACCCCGACACGTTCAAC
AGTGTCTGCGCCAGAATGATGCAGAAGATGATTGAAGTCGTTCCGTCGGGTGTGGTGCTCACTGATCCGATTTCGATCTACGATGTCAAGCCGAGCGGACTTCAGCTGACGCTGCTTGGT
GGAGGGGAGTCCATAAAGCTTACTGGAGATATTCGTGTCAGAACCACTGAGCGTGCTGCAAGTCAAATCGAGAGCGTGGAACTTGTGTATAAGGGTCGTGATGGAGCCGAATCCTCAACA
GCCTTGAGTACTGAGTCTTCAGGGTCGGCGTCCGGCTTCGACGACAGCTTCGAG
GTTTGCATTACCCTGAAATCTTGCTGAGACGTCCCACTAATGCAAACAGTTCTACGGTATCTTCGC
AAACATCCCAGCCGATTCCGGAATCTCGTCTTTCACCGTCCGCATCGCCCTCACGAGCGGTGAAACCGAGCTCCACGACAACAACGGCAGCGGCTTCCCCCTAAAAGACACCGTCTTCTT
CCAAAGCCCGCAGAGCTGCCTCGCCGGCACCTCCATGACCGTCACCGCAGCCGTGCTCACCACGCAATCCGCACCCACCCTCAACGTCACCACCAAGGTCCCCAACTCCCGCTCCGTCCT
CCCCTCCCTCTCAGCCGCCACCGTCGCCATGACGAAAGGGTCCTCCGTCGGCCCATACGACCTGTACTCCGTCACCGTCACGCTCACCTCCGCGCAACTCGACGACACCCGCTTCGACGT
CAAAGTCGGCAGCGCCATCGACGCCTTCAAGTCCTCCGCCGACCTCGGCGACACCTGCCAGGACCTCAGCCCCGCC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGACATCCCTGCCTGACCCTGGTGTGGGTCGCAGGCGCCGTCTACAACGCCATTGGCGCCGCCGCCGCCCCGACATGGCCCTCCTCCACGGACGAATTGGAGGATATCATGGTC
CTCAACACCGGTTACCGCGCCCGCGACTTCGCAGTGCCCGTCACCCCCTGCGGCTTCTCACCCGAAGGCGCCGGACGCGTGCAGGCCGCCGAATGGATACGGACGGCCTTCCACGACATG
GCCGGCGGGAGCGTGTACACTGGAATCGGAGGCCTGGATGCGTCAATAGCCTACGAAACGCGGAGTCTCGAGAACGTTGGCCCGGCGTTCAACACGACACTGGCCACGTACGCGCCGTAT
TTGACGAGCAGGTCCTCGATGGCTGACCTTATTGCCCTGGGTGTCTACACGGCGGTGCGATCTTGCGGAGGGCCAATTGTGCCTATACGGACCGGCAGAGTGGATGCCACGGCAGCAGGG
CCGCAGGGGGTGCCGCTGCCGCAGAACTCACTCGGGACATTCCAGAATCAATTCCTGCGAACGGGCTTCAATAGTACGGAAATGATCCAGGTGGTGGCGTGCGGACACACGTTGGGAGGT
GTACACTCAGCGAACAACCCGGAAATTGTGCCCGTAGGAACAGCGGAAGATGAAGTTGTCAAGTTCGACACAACGGACGCATTTGATAACAAAGTCGTCACTGAGTACCTCTCGAACACT
ACCAAGAACGCCCTTGTGGTGGGCCCTTCTACGAGTAACGGGCGGAACTCAGACGCGCGTGTGTTTGCTTCGGATAAAAATGTGACTGTCAGGGCTCTGACGGACCCCGACACGTTCAAC
AGTGTCTGCGCCAGAATGATGCAGAAGATGATTGAAGTCGTTCCGTCGGGTGTGGTGCTCACTGATCCGATTTCGATCTACGATGTCAAGCCGAGCGGACTTCAGCTGACGCTGCTTGGT
GGAGGGGAGTCCATAAAGCTTACTGGAGATATTCGTGTCAGAACCACTGAGCGTGCTGCAAGTCAAATCGAGAGCGTGGAACTTGTGTATAAGGGTCGTGATGGAGCCGAATCCTCAACA
GCCTTGAGTACTGAGTCTTCAGGGTCGGCGTCCGGCTTCGACGACAGCTTCGAG
TTCTACGGTATCTTCGCAAACATCCCAGCCGATTCCGGAATCTCGTCTTTCACCGTCCGCATCGCC
CTCACGAGCGGTGAAACCGAGCTCCACGACAACAACGGCAGCGGCTTCCCCCTAAAAGACACCGTCTTCTTCCAAAGCCCGCAGAGCTGCCTCGCCGGCACCTCCATGACCGTCACCGCA
GCCGTGCTCACCACGCAATCCGCACCCACCCTCAACGTCACCACCAAGGTCCCCAACTCCCGCTCCGTCCTCCCCTCCCTCTCAGCCGCCACCGTCGCCATGACGAAAGGGTCCTCCGTC
GGCCCATACGACCTGTACTCCGTCACCGTCACGCTCACCTCCGCGCAACTCGACGACACCCGCTTCGACGTCAAAGTCGGCAGCGCCATCGACGCCTTCAAGTCCTCCGCCGACCTCGGC
GACACCTGCCAGGACCTCAGCCCCGCC

Retrieve as FASTA