Entry information : PterCcP01
Entry ID 11710
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PterCcP01
Name PterCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora teres    [TaxId: 53485 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PterCcP01
start..stop
S start..stop
PtritCcP 767 0 1..374 1..374
AalteCcP01 733 0 1..374 1..374
AbraCcP 721 0 1..374 1..373
CheCcP_C4 708 0 1..374 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4873..5285 413 N° 2 4102..4813 712  
complement(join(4102..4813,4873..5285))


exon

Literature and cross-references PterCcP01
DNA ref. JGI genome:   190592 (5285..4102)
Cluster/Prediction ref. JGI gene:   376
Protein sequence: PterCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   375
PWM (Da):   %s   42139.64  
PI (pH):   %s   8.27
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASRNFSRALRTAAPSFRTTSTRSSARFVAPAQNAFRNQRRGYASQEDGPDMHEGNPTGLAWGAGALLVGVGVYSLYTYKPELFGQTNTKKIFTPRFEDYQKVYDHIAKLLQDHDDYDDGSYGPVLLRLAWHASGTYDKMTNTGGSNGATMRFAPEGDHGANAGLKAARDFLEPVKESFPWITYSDLWILAGVCAIQEMQGPKIPYRAGRTDRDVSFCTPDGRLPDASKDRSHIRAIFGRMGFDDRAMVALSGAHALGRCHTDRSGYDGPWTFSPTTLTNDYFKLLLEEKWQYKKWNGPKQFEDVKTKSLMMLPTDMELVKDKSFKKYTDLYAKDNDAFFKDFSESVCTLFELGVPFQQPEDQRYVFKSSFD

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCTCGAAACTTTTCTCGCGCCCTGCGCACCGCTGCGCCCTCATTTCGCACCACATCGACTCGCTCGTCTGCCCGCTTCGTCGCTCCCGCACAAAACGCTTTCCGTAAC
CAGCGACGCGGATACGCTTCCCAGGAGGATGGCCCAGACATGCATGAGGGCAACCCCACTGGTCTAGCATGGGGTGCTGGCGCTCTCCTCGTCGGTGTTGGTGTATACAGTCTGTACACG
TACAAGCCAGAGTTGTTCGGTCAGACCAACACCAAGAAAATCTTCACCCCGCGCTTCGAGGACTACCAGAAGGTTTACGATCATATTGCGAAGCTGCTGCAGGATCACGATGATTACGAT
GATGGCAGCTACGGACCCGTGCTGCTTCGCCTGGCATGGCACGCTTCTGGAAC
GTGAGTATACTCTACTCATGTGTCTTTGTTGAATGGAACCAGAGACTAACATACCACAGCTACGACA
AGATGACCAACACGGGTGGTTCCAACGGCGCCACCATGCGCTTTGCCCCCGAAGGTGACCACGGCGCCAACGCCGGTCTAAAGGCTGCCCGCGACTTCCTTGAGCCCGTCAAGGAGTCCT
TCCCCTGGATCACATACTCTGATCTCTGGATCCTCGCCGGCGTCTGCGCCATTCAAGAGATGCAAGGTCCCAAGATCCCCTACCGCGCCGGCCGCACCGACCGCGACGTATCCTTCTGCA
CACCCGACGGTCGCCTCCCAGACGCGAGCAAGGACCGTAGCCACATCCGCGCCATCTTCGGCCGCATGGGCTTCGACGACCGCGCTATGGTTGCTCTGTCTGGTGCTCACGCTCTGGGCC
GCTGCCACACCGACCGCTCTGGCTACGACGGCCCCTGGACCTTCTCTCCTACTACCCTGACCAACGACTACTTCAAGCTGCTGCTCGAGGAGAAGTGGCAATACAAGAAGTGGAATGGCC
CCAAGCAGTTCGAGGACGTCAAAACTAAGAGCCTCATGATGCTGCCTACGGATATGGAGCTTGTCAAGGACAAGAGTTTCAAAAAGTACACTGATCTGTATGCCAAGGACAACGATGCTT
TCTTCAAGGACTTTTCAGAGTCTGTTTGCACCCTGTTTGAACTCGGTGTACCGTTCCAGCAGCCAGAGGACCAGCGCTACGTCTTCAAGAGCTCTTTTGATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCTCGAAACTTTTCTCGCGCCCTGCGCACCGCTGCGCCCTCATTTCGCACCACATCGACTCGCTCGTCTGCCCGCTTCGTCGCTCCCGCACAAAACGCTTTCCGTAAC
CAGCGACGCGGATACGCTTCCCAGGAGGATGGCCCAGACATGCATGAGGGCAACCCCACTGGTCTAGCATGGGGTGCTGGCGCTCTCCTCGTCGGTGTTGGTGTATACAGTCTGTACACG
TACAAGCCAGAGTTGTTCGGTCAGACCAACACCAAGAAAATCTTCACCCCGCGCTTCGAGGACTACCAGAAGGTTTACGATCATATTGCGAAGCTGCTGCAGGATCACGATGATTACGAT
GATGGCAGCTACGGACCCGTGCTGCTTCGCCTGGCATGGCACGCTTCTGGAAC
CTACGACAAGATGACCAACACGGGTGGTTCCAACGGCGCCACCATGCGCTTTGCCCCCGAAGGTGAC
CACGGCGCCAACGCCGGTCTAAAGGCTGCCCGCGACTTCCTTGAGCCCGTCAAGGAGTCCTTCCCCTGGATCACATACTCTGATCTCTGGATCCTCGCCGGCGTCTGCGCCATTCAAGAG
ATGCAAGGTCCCAAGATCCCCTACCGCGCCGGCCGCACCGACCGCGACGTATCCTTCTGCACACCCGACGGTCGCCTCCCAGACGCGAGCAAGGACCGTAGCCACATCCGCGCCATCTTC
GGCCGCATGGGCTTCGACGACCGCGCTATGGTTGCTCTGTCTGGTGCTCACGCTCTGGGCCGCTGCCACACCGACCGCTCTGGCTACGACGGCCCCTGGACCTTCTCTCCTACTACCCTG
ACCAACGACTACTTCAAGCTGCTGCTCGAGGAGAAGTGGCAATACAAGAAGTGGAATGGCCCCAAGCAGTTCGAGGACGTCAAAACTAAGAGCCTCATGATGCTGCCTACGGATATGGAG
CTTGTCAAGGACAAGAGTTTCAAAAAGTACACTGATCTGTATGCCAAGGACAACGATGCTTTCTTCAAGGACTTTTCAGAGTCTGTTTGCACCCTGTTTGAACTCGGTGTACCGTTCCAG
CAGCCAGAGGACCAGCGCTACGTCTTCAAGAGCTCTTTTGATTAA

Retrieve as FASTA