Entry information : AcarCcP01
Entry ID 11717
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AcarCcP01
Name AcarCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus carbonarius    [TaxId: 40993 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcarCcP01
start..stop
S start..stop
AnCcP01 616 0 1..311 1..313
AacuCcP01 565 0 1..311 1..313
AorCcP01 558 0 1..311 1..312
AflCcP01 558 0 1..311 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1023883..1023992 110 N° 2 1023007..1023832 826  
complement(join(1023007..1023832,1023883..1023992))


exon

Literature and cross-references AcarCcP01
DNA ref. JGI genome:   scaffold_1 (1023992..1023007)
Cluster/Prediction ref. JGI gene:   202415
Protein sequence: AcarCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312
PWM (Da):   %s   34524.29  
PI (pH):   %s   6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSPGDYDAVRKDIVAQLKKPDYDDGSAGPVFVRLAWHSAGTYDAETDTGGSNGAGMRYEAEGGDPSNAGLQYGRAFLEPVKEKHPWITYSDLWTLAGVVAIKELGGPEVEWKSGRTDLVDDSKVPPRGRLPDGAQGADHLRFIFNRMGFNDQEIVALAGGHNLGRCHTDRSGFEGPWVNNPTRFSNQFFKLLLQLKWTPRKLANGMSQFVYEDPDAEEGDELLMMLPTDVALKTDPSFRQWVERYAEDKDLFFDHFAKAFAKLVELGIRRDEKDAILNTDNVKGGYISAPKKSNTPTGPPRKPKAPRARL

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAGTCCGGGCGATTACGACGCCGTCCGCAAGGACATTGTCGCACAACTGAAGAAGCCCGATTACGACGATGGAAGCGCAGGTCCAGTGTTTGTCCGTCTGGCATGGTGAGTTTTG
CAGTATTGTTCCTCCCAACTCGCCACTGACCCCTGAATAGGCACTCCGCCGGTACCTACGACGCCGAGACCGACACGGGCGGCAGCAACGGCGCGGGCATGCGATATGAAGCTGAGGGCG
GCGATCCATCAAATGCAGGTCTGCAATACGGTCGAGCATTCCTAGAACCAGTGAAGGAGAAGCACCCGTGGATCACATACTCCGATCTATGGACGTTAGCAGGTGTCGTGGCGATCAAGG
AGCTGGGCGGGCCGGAAGTCGAGTGGAAGTCCGGTCGGACCGACTTGGTCGACGACTCCAAGGTGCCGCCCCGTGGGCGTCTACCCGATGGCGCGCAGGGTGCCGATCATCTTCGCTTTA
TCTTCAACCGGATGGGCTTCAACGACCAGGAGATCGTGGCGTTGGCGGGAGGACACAACCTGGGTCGGTGTCACACCGACCGCAGTGGATTCGAGGGTCCCTGGGTGAACAACCCGACGC
GATTCTCCAACCAGTTCTTCAAGCTATTGTTACAGTTGAAGTGGACACCGCGGAAGTTGGCGAACGGCATGAGCCAATTTGTGTATGAGGACCCGGACGCGGAGGAGGGAGACGAGTTGT
TGATGATGCTGCCCACCGATGTGGCGCTTAAAACCGACCCATCGTTCCGACAGTGGGTGGAGAGGTATGCGGAGGATAAGGACCTGTTCTTCGATCACTTCGCGAAGGCGTTTGCGAAGT
TGGTCGAGCTGGGTATTAGACGTGATGAGAAGGACGCTATTCTCAACACCGACAACGTTAAGGGAGGATACATCTCTGCTCCCAAGAAGAGCAACACGCCAACTGGACCCCCGAGGAAGC
CCAAAGCCCCGCGGGCCCGGCTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAGTCCGGGCGATTACGACGCCGTCCGCAAGGACATTGTCGCACAACTGAAGAAGCCCGATTACGACGATGGAAGCGCAGGTCCAGTGTTTGTCCGTCTGGCATGGCACTCCGCC
GGTACCTACGACGCCGAGACCGACACGGGCGGCAGCAACGGCGCGGGCATGCGATATGAAGCTGAGGGCGGCGATCCATCAAATGCAGGTCTGCAATACGGTCGAGCATTCCTAGAACCA
GTGAAGGAGAAGCACCCGTGGATCACATACTCCGATCTATGGACGTTAGCAGGTGTCGTGGCGATCAAGGAGCTGGGCGGGCCGGAAGTCGAGTGGAAGTCCGGTCGGACCGACTTGGTC
GACGACTCCAAGGTGCCGCCCCGTGGGCGTCTACCCGATGGCGCGCAGGGTGCCGATCATCTTCGCTTTATCTTCAACCGGATGGGCTTCAACGACCAGGAGATCGTGGCGTTGGCGGGA
GGACACAACCTGGGTCGGTGTCACACCGACCGCAGTGGATTCGAGGGTCCCTGGGTGAACAACCCGACGCGATTCTCCAACCAGTTCTTCAAGCTATTGTTACAGTTGAAGTGGACACCG
CGGAAGTTGGCGAACGGCATGAGCCAATTTGTGTATGAGGACCCGGACGCGGAGGAGGGAGACGAGTTGTTGATGATGCTGCCCACCGATGTGGCGCTTAAAACCGACCCATCGTTCCGA
CAGTGGGTGGAGAGGTATGCGGAGGATAAGGACCTGTTCTTCGATCACTTCGCGAAGGCGTTTGCGAAGTTGGTCGAGCTGGGTATTAGACGTGATGAGAAGGACGCTATTCTCAACACC
GACAACGTTAAGGGAGGATACATCTCTGCTCCCAAGAAGAGCAACACGCCAACTGGACCCCCGAGGAAGCCCAAAGCCCCGCGGGCCCGGCTGTAG

Retrieve as FASTA