Entry information : AcarCIIAA01
Entry ID 11718
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AcarCIIAA01
Name AcarCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus carbonarius    [TaxId: 40993 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcarCIIAA01
start..stop
S start..stop
AwenCIIAA01 426 3e-149 8..335 26..353
MbicCIIAA01 392 2e-136 1..338 21..357
MvarCIIAA01 385 7e-134 1..339 21..353
Ssrc1lsm3aCIIAA01 348 4e-119 1..332 25..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 747288..747443 156 N° 2 747495..748141 647 N° 3 748202..748277 76 N° 4 748352..748603 252
join(747288..747443,747495..748141,748202..748277,748352..748603)


exon

Literature and cross-references AcarCIIAA01
DNA ref. JGI genome:   scaffold_2 (747288..748603)
Cluster/Prediction ref. JGI gene:   160478
Protein sequence: AcarCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   378
PWM (Da):   %s   40457.89  
PI (pH):   %s   4.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQDLLHEITRRQSSSGNSQLIGDLIGGATTPVGRRVRDCITGGSSCELQTGKNYERPGSLDSAACRADACCAWDFVQQDLVDRFRNENGTCNGLARAAVRLGFHDAGTWSMTSDIGGADGSLLLSSDEIERPENNGLQEIRSEGLRILDRYSSNGVTAADLVQFMHNVATVTCPLGPRLLTLVGREDRHEADPMGLIPSNNATNASYLIELFENKTITPQDLAALLGAHTVAQQFYVNPARAGQALDTTPGVWDTNFYQEMALPNSPPNVFRLPSDEALSLADGISQSFDTFTDVTSGQTVWNAQYASAYVRLSLLGVNKINQLTDCSHVLPDAITSFSASSSTPSSTSLGVPLLPNNPHVMIPGLVMGVFLSMPFV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGATTTGCTCCATGAGATTACACGTCGACAGTCGAGCTCGGGGAATAGTCAACTTATTGGAGATCTCATTGGCGGGGCTACCACGCCAGTGGGAAGACGGGTGCGCGATTGTATC
ACAGGGGGCTCATCCTGTGAACTCCAAACCGGAAAG
GTTGGTGCACCATGGAGGTTCTGCGACGGTTGAGTTACTCATGGGAAATAGAACTACGAGCGCCCAGGCAGCTTAGACAGTGCC
GCGTGTCGAGCCGATGCATGTTGTGCTTGGGATTTTGTGCAGCAAGATCTGGTCGACAGATTCCGGAATGAAAACGGCACCTGTAATGGCCTGGCCCGCGCCGCAGTGAGATTAGGATTC
CATGATGCCGGGACATGGTCGATGACAAGCGATATTGGTGGCGCGGATGGTAGCTTACTCCTCAGCTCCGATGAAATCGAGCGACCAGAGAACAATGGTCTTCAAGAGATTCGATCCGAA
GGGTTGCGAATCCTGGACAGGTACTCAAGCAACGGGGTCACCGCTGCAGATTTGGTGCAGTTCATGCACAATGTCGCCACAGTGACCTGCCCTTTAGGCCCTAGACTGCTGACCCTGGTC
GGGCGAGAGGACAGACACGAAGCGGACCCTATGGGTCTCATTCCATCCAACAATGCGACCAATGCATCCTACCTTATTGAGTTATTTGAAAACAAGACCATCACTCCTCAAGACCTAGCT
GCCCTCCTGGGTGCACATACCGTTGCCCAGCAATTCTACGTGAATCCCGCGCGTGCAGGCCAAGCACTGGACACAACCCCAGGGGTGTGGGACACGAATTTTTATCAAGAGATGGCACTT
CCCAATTCTCCTCC
GTAAGGCTACTATGACATTCAGCCATTGATCCAATGCTAACATGGCCACAACTCCTTTAGGAACGTCTTCCGCCTCCCAAGCGACGAAGCACTTTCCTTAGCCGAC
GGCATCTCTCAAAGCTTCGACACATTTACC
GTACGTATTACTAGTAATATGTCTGCGTTATATAAACGCCCACCAACTAACAAAGTACTACTACCTACTCTTAGGACGTTACATCTGGTC
AAACAGTATGGAACGCGCAATACGCCTCGGCCTATGTGCGCCTCAGTCTCCTTGGCGTGAACAAGATCAACCAGCTTACCGACTGCAGTCATGTGCTGCCTGATGCCATTACCTCATTCT
CAGCGTCCTCGTCAACACCTTCCTCGACCTCTTTGGGCGTGCCACTATTGCCCAATAATCCTCACGTTATGATCCCCGGATTAGTCATGGGAGTATTCCTATCTATGCCGTTTGTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGATTTGCTCCATGAGATTACACGTCGACAGTCGAGCTCGGGGAATAGTCAACTTATTGGAGATCTCATTGGCGGGGCTACCACGCCAGTGGGAAGACGGGTGCGCGATTGTATC
ACAGGGGGCTCATCCTGTGAACTCCAAACCGGAAAG
AACTACGAGCGCCCAGGCAGCTTAGACAGTGCCGCGTGTCGAGCCGATGCATGTTGTGCTTGGGATTTTGTGCAGCAAGATCTG
GTCGACAGATTCCGGAATGAAAACGGCACCTGTAATGGCCTGGCCCGCGCCGCAGTGAGATTAGGATTCCATGATGCCGGGACATGGTCGATGACAAGCGATATTGGTGGCGCGGATGGT
AGCTTACTCCTCAGCTCCGATGAAATCGAGCGACCAGAGAACAATGGTCTTCAAGAGATTCGATCCGAAGGGTTGCGAATCCTGGACAGGTACTCAAGCAACGGGGTCACCGCTGCAGAT
TTGGTGCAGTTCATGCACAATGTCGCCACAGTGACCTGCCCTTTAGGCCCTAGACTGCTGACCCTGGTCGGGCGAGAGGACAGACACGAAGCGGACCCTATGGGTCTCATTCCATCCAAC
AATGCGACCAATGCATCCTACCTTATTGAGTTATTTGAAAACAAGACCATCACTCCTCAAGACCTAGCTGCCCTCCTGGGTGCACATACCGTTGCCCAGCAATTCTACGTGAATCCCGCG
CGTGCAGGCCAAGCACTGGACACAACCCCAGGGGTGTGGGACACGAATTTTTATCAAGAGATGGCACTTCCCAATTCTCCTCC
GAACGTCTTCCGCCTCCCAAGCGACGAAGCACTTTCC
TTAGCCGACGGCATCTCTCAAAGCTTCGACACATTTACC
GACGTTACATCTGGTCAAACAGTATGGAACGCGCAATACGCCTCGGCCTATGTGCGCCTCAGTCTCCTTGGCGTGAACAAG
ATCAACCAGCTTACCGACTGCAGTCATGTGCTGCCTGATGCCATTACCTCATTCTCAGCGTCCTCGTCAACACCTTCCTCGACCTCTTTGGGCGTGCCACTATTGCCCAATAATCCTCAC
GTTATGATCCCCGGATTAGTCATGGGAGTATTCCTATCTATGCCGTTTGTG

Retrieve as FASTA