Entry information : AwenCIIAA01
Entry ID 11719
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2017-05-23 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-05-23 (Catherine Mathe)
Peroxidase information: AwenCIIAA01
Name AwenCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus wentii    [TaxId: 5066 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AwenCIIAA01
start..stop
S start..stop
AcarCIIAA01 409 2e-142 26..353 8..335
MbicCIIAA01 400 4e-139 5..356 2..357
MvarCIIAA01 384 4e-133 14..357 16..353
Ssrc1lsm3aCIIAA01 339 3e-115 7..349 13..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 535931..536140 210 N° 2 535235..535881 647 N° 3 535099..535174 76 N° 4 534783..535034 252
complement(join(534783..535034,535099..535174,535235..535881,535931..536140))


exon

Literature and cross-references AwenCIIAA01
DNA ref. JGI genome:   scaffold_10 (536140..534783)
Cluster/Prediction ref. JGI gene:   177613 [Incorrect prediction]
Protein sequence: AwenCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   394 (374)
PWM (Da):   %s   42225.95 (39885.7)  
PI (pH):   %s   4.63 (4.50) Peptide Signal:   %s   cut: 21 range:21-394
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRISKLLLFALPAMAFSTMAFLPDIVSRQSASSDTTEIIPGLSDGATTEVGRQVRDCLGGTQSCEDNSTKNYTAPGPLGSSECTNDACCVWDYIQRDLVQIFQSLDGTCSRLARSSVRLGFHDAGTWSTTSGYGGADGSLLLSSDEINRFENNGLQQVRSTALGILDSYSQYEIVAADLVQFMHNVATVVCPLGPRIVTLIGLNDSSVANPSGLVPGNNATDGEYLIELFRNKTLKPRDLVALVGAHTVGQQYFVDPSRAGQPLDSTPGVWDVDFYREVTSSNSHPGGFRLSSDEALANTDETSSSFTAFGDRNTGQTVWNAEYATAYVRLSLLGVDNINHLTHCTKVLLDAVTSFSSPSSTPTSPSSSLKILRRISLTSVFAWVALLAPVSLF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from JGI (missing signal peptide)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAATCTCAAAGTTGCTTCTGTTTGCTCTGCCAGCCATGGCATTTTCCACCATGGCCTTTCTCCCAGACATAGTGAGTCGGCAGTCTGCCAGCTCTGACACGACGGAAATTATTCCA
GGCTTAAGTGACGGAGCAACAACAGAGGTGGGAAGGCAAGTGAGAGACTGCCTTGGTGGCACGCAGTCCTGTGAAGACAATTCAACCAAG
GTGTGTCCCTTCCCAGTCGCTTCAGATCCG
TCTTTCTGATGCCAGAAAGAACTACACTGCTCCTGGGCCACTAGGCAGCAGTGAATGCACAAACGACGCATGCTGCGTGTGGGATTATATCCAGCGGGACTTGGTACAGATATTCCAAAG
CCTCGATGGAACCTGCTCTCGTCTTGCCCGCTCCTCTGTGCGTCTTGGATTCCACGACGCCGGGACATGGTCAACCACCAGTGGGTATGGTGGAGCAGACGGCAGCTTACTCCTGAGCTC
TGATGAGATCAATCGCTTCGAGAACAATGGTCTCCAGCAGGTCCGATCAACCGCCCTTGGCATCCTGGACTCTTATTCGCAATATGAAATTGTAGCCGCAGACCTGGTTCAATTCATGCA
TAATGTAGCAACGGTGGTCTGTCCGTTAGGACCGAGAATCGTAACGCTGATTGGGCTCAATGATAGCAGTGTTGCGAATCCATCCGGACTAGTCCCAGGAAATAATGCCACAGATGGCGA
ATACTTGATTGAGCTGTTTCGAAACAAGACCTTGAAACCTCGCGATCTCGTTGCTCTCGTTGGCGCCCATACTGTCGGTCAGCAGTACTTTGTGGATCCTTCTCGTGCTGGACAACCCCT
GGATTCTACCCCAGGTGTCTGGGATGTCGACTTTTACCGCGAGGTCACCTCGTCCAATTCTCATCC
GTAAGATCATCGAAGCAATCAGTTTGTTTTGATAGCTAACCATGGCTTGGTTTG
ATCCAGAGGGGGTTTCCGTCTATCAAGTGACGAAGCCCTTGCCAATACAGACGAAACTTCATCCAGCTTCACGGCATTTGGAGTAAGTGACCTTGATGTAATTCATCACAACCCAATGGA
TACCAACTCACTTCCCTTGCCGACAGGATCGAAACACTGGCCAGACAGTTTGGAATGCCGAATATGCCACTGCCTATGTCCGTCTTAGTCTCCTCGGGGTTGACAACATCAACCATCTTA
CGCACTGTACAAAGGTTCTTCTGGATGCAGTGACATCATTTTCATCTCCATCAAGCACTCCTACCTCGCCATCTTCTTCGCTGAAGATTCTGCGTCGGATATCATTGACTTCGGTGTTTG
CTTGGGTGGCTTTGTTGGCTCCTGTATCTTTATTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAATCTCAAAGTTGCTTCTGTTTGCTCTGCCAGCCATGGCATTTTCCACCATGGCCTTTCTCCCAGACATAGTGAGTCGGCAGTCTGCCAGCTCTGACACGACGGAAATTATTCCA
GGCTTAAGTGACGGAGCAACAACAGAGGTGGGAAGGCAAGTGAGAGACTGCCTTGGTGGCACGCAGTCCTGTGAAGACAATTCAACCAAG
AACTACACTGCTCCTGGGCCACTAGGCAGC
AGTGAATGCACAAACGACGCATGCTGCGTGTGGGATTATATCCAGCGGGACTTGGTACAGATATTCCAAAGCCTCGATGGAACCTGCTCTCGTCTTGCCCGCTCCTCTGTGCGTCTTGGA
TTCCACGACGCCGGGACATGGTCAACCACCAGTGGGTATGGTGGAGCAGACGGCAGCTTACTCCTGAGCTCTGATGAGATCAATCGCTTCGAGAACAATGGTCTCCAGCAGGTCCGATCA
ACCGCCCTTGGCATCCTGGACTCTTATTCGCAATATGAAATTGTAGCCGCAGACCTGGTTCAATTCATGCATAATGTAGCAACGGTGGTCTGTCCGTTAGGACCGAGAATCGTAACGCTG
ATTGGGCTCAATGATAGCAGTGTTGCGAATCCATCCGGACTAGTCCCAGGAAATAATGCCACAGATGGCGAATACTTGATTGAGCTGTTTCGAAACAAGACCTTGAAACCTCGCGATCTC
GTTGCTCTCGTTGGCGCCCATACTGTCGGTCAGCAGTACTTTGTGGATCCTTCTCGTGCTGGACAACCCCTGGATTCTACCCCAGGTGTCTGGGATGTCGACTTTTACCGCGAGGTCACC
TCGTCCAATTCTCATCC
AGGGGGTTTCCGTCTATCAAGTGACGAAGCCCTTGCCAATACAGACGAAACTTCATCCAGCTTCACGGCATTTGGAGATCGAAACACTGGCCAGACAGTTTGG
AATGCCGAATATGCCACTGCCTATGTCCGTCTTAGTCTCCTCGGGGTTGACAACATCAACCATCTTACGCACTGTACAAAGGTTCTTCTGGATGCAGTGACATCATTTTCATCTCCATCA
AGCACTCCTACCTCGCCATCTTCTTCGCTGAAGATTCTGCGTCGGATATCATTGACTTCGGTGTTTGCTTGGGTGGCTTTGTTGGCTCCTGTATCTTTATTCTAA

Retrieve as FASTA