Entry information : AnCcP02
Entry ID 11724
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnCcP02
Name AnCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnCcP02
start..stop
S start..stop
AcarCcP02 663 0 12..364 12..366
AwenCcP02 619 0 1..364 1..365
NfCcP02 615 0 12..364 12..366
AclCcP02 612 0 12..364 12..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1041231..1041587 357 N° 2 1040421..1041158 738  
complement(join(1040421..1041158,1041231..1041587))


exon

Literature and cross-references AnCcP02
DNA ref. JGI genome:   chr_6_2 (1041587..1040421)
Cluster/Prediction ref. JGI gene:   213025
Protein sequence: AnCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365
PWM (Da):   %s   40164.99  
PI (pH):   %s   8.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAARTASRAFLRSTPATSSFRPAARSARFALPSQGFRAASRRGYASEAGEAKSSNSLLWAGIAAAGGVGAYFYLKGGDASVSSKDFVPTKEDYQKVYDAIAHRLANETDYDDGSYGPVLVRLAWHASGTYDKETGTGGSNGATMRFAPESDHGANAGLKHARDFLEPIKAQFPWITYSDLWTLAGACAIQELGGPAIPWRPGREDKDVAACTPDGRLPDATKEQSHIRDIFYRMGFNDQEIVALVGAHSLGRAHTDRSGFDGPWDFSPTVFTNEFFRLLVEEKWQQRKWNGPKQFTDKTTGTLMMMPADLALTKDKAFRKYVELYAKDSDLFFKDFSNVFVKLLELGVPFKTEDRYVFKTSE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Incorrect prediction from JGI (CCP and DNAJ ORFs have been fused).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCGCTGCTAGAACGGCTTCCCGGGCCTTCCTTCGCTCGACCCCCGCTACCTCTTCCTTCAGACCTGCTGCTCGCAGTGCTCGCTTTGCCCTCCCCTCTCAGGGCTTCCGTGCT
GCCTCTCGCCGCGGCTATGCCTCTGAGGCTGGTGAGGCCAAGTCCTCTAACAGCCTCCTGTGGGCTGGTATTGCCGCCGCTGGTGGTGTTGGCGCCTACTTCTACCTGAAGGGTGGTGAT
GCCTCCGTCAGCTCCAAGGACTTTGTCCCCACCAAGGAGGACTATCAGAAGGTGTACGATGCCATTGCTCACCGTCTTGCCAACGAGACCGACTATGACGATGGCAGCTATGGACCC
GTA
AGTGACACCCACCATCTGATGACCTTGAGCCATTGAGTACATGGGAAGCTGACACTTGTTGTTGGATAGGTTCTTGTCCGTCTGGCATGGCACGCAAGCGGTACCTACGACAAGGAGACT
GGCACTGGTGGAAGCAACGGTGCTACCATGAGATTTGCCCCCGAGTCCGACCACGGCGCCAACGCTGGTCTCAAGCACGCCAGAGACTTTTTGGAGCCCATCAAGGCCCAGTTCCCCTGG
ATCACCTACTCCGACCTGTGGACCCTGGCTGGTGCCTGCGCCATCCAGGAGCTTGGTGGCCCTGCCATCCCTTGGAGACCTGGCCGTGAGGACAAGGACGTTGCTGCTTGCACCCCTGAC
GGACGTCTTCCCGACGCCACCAAGGAGCAGTCGCACATCCGTGACATCTTCTACCGCATGGGATTCAACGACCAGGAGATCGTTGCTCTGGTTGGAGCTCACTCCCTTGGTCGCGCCCAC
ACTGACCGCTCCGGCTTCGACGGTCCCTGGGACTTCAGCCCTACCGTCTTCACCAACGAGTTCTTCCGTCTGTTGGTGGAGGAGAAGTGGCAGCAGCGCAAGTGGAACGGCCCTAAGCAG
TTCACTGACAAGACCACTGGTACCCTGATGATGATGCCCGCTGACCTTGCCCTGACCAAGGACAAGGCCTTCCGCAAGTACGTCGAGCTCTATGCTAAGGACAGCGACCTCTTCTTCAAG
GACTTCTCCAATGTGTTCGTCAAGCTCCTCGAACTTGGTGTCCCCTTCAAGACTGAGGACCGCTATGTCTTCAAGACCTCTGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCGCTGCTAGAACGGCTTCCCGGGCCTTCCTTCGCTCGACCCCCGCTACCTCTTCCTTCAGACCTGCTGCTCGCAGTGCTCGCTTTGCCCTCCCCTCTCAGGGCTTCCGTGCT
GCCTCTCGCCGCGGCTATGCCTCTGAGGCTGGTGAGGCCAAGTCCTCTAACAGCCTCCTGTGGGCTGGTATTGCCGCCGCTGGTGGTGTTGGCGCCTACTTCTACCTGAAGGGTGGTGAT
GCCTCCGTCAGCTCCAAGGACTTTGTCCCCACCAAGGAGGACTATCAGAAGGTGTACGATGCCATTGCTCACCGTCTTGCCAACGAGACCGACTATGACGATGGCAGCTATGGACCC
GTT
CTTGTCCGTCTGGCATGGCACGCAAGCGGTACCTACGACAAGGAGACTGGCACTGGTGGAAGCAACGGTGCTACCATGAGATTTGCCCCCGAGTCCGACCACGGCGCCAACGCTGGTCTC
AAGCACGCCAGAGACTTTTTGGAGCCCATCAAGGCCCAGTTCCCCTGGATCACCTACTCCGACCTGTGGACCCTGGCTGGTGCCTGCGCCATCCAGGAGCTTGGTGGCCCTGCCATCCCT
TGGAGACCTGGCCGTGAGGACAAGGACGTTGCTGCTTGCACCCCTGACGGACGTCTTCCCGACGCCACCAAGGAGCAGTCGCACATCCGTGACATCTTCTACCGCATGGGATTCAACGAC
CAGGAGATCGTTGCTCTGGTTGGAGCTCACTCCCTTGGTCGCGCCCACACTGACCGCTCCGGCTTCGACGGTCCCTGGGACTTCAGCCCTACCGTCTTCACCAACGAGTTCTTCCGTCTG
TTGGTGGAGGAGAAGTGGCAGCAGCGCAAGTGGAACGGCCCTAAGCAGTTCACTGACAAGACCACTGGTACCCTGATGATGATGCCCGCTGACCTTGCCCTGACCAAGGACAAGGCCTTC
CGCAAGTACGTCGAGCTCTATGCTAAGGACAGCGACCTCTTCTTCAAGGACTTCTCCAATGTGTTCGTCAAGCTCCTCGAACTTGGTGTCCCCTTCAAGACTGAGGACCGCTATGTCTTC
AAGACCTCTGAGTAG

Retrieve as FASTA