Entry information : PEchCcP02
Entry ID 11725
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: PEchCcP02
Name PEchCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Penicillium
Organism Penicillium chrysogenum    [TaxId: 5076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PEchCcP02
start..stop
S start..stop
AwenCcP02 608 0 1..365 1..365
AnCcP02 597 0 12..365 12..364
AclCcP02 594 0 12..365 12..366
NfCcP02 581 0 12..365 12..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3730468..3730827 360 N° 2 3729654..3730391 738  
complement(join(3729654..3730391,3730468..3730827))


exon

Literature and cross-references PEchCcP02
DNA ref. JGI genome:   scaffold_3 (3730827..3729654)
Cluster/Prediction ref. JGI gene:   26257
Protein sequence: PEchCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366
PWM (Da):   %s   40112.9  
PI (pH):   %s   8.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAARTASRAFLRSTPATSSFRPAARSTRFAIPANGLRASPRRGYASEAGPEKSGSSFGIWALGLGALGGGAYFYLNGDSASSPKKPFVPTQADYQKVYDAVAARLADDTDYDDGSYGPVLVRLAWHASGTYDKETGTGGSNGATMRFAPESDHGANAGLKTARDFLEPIKAQFPWITYSDLWTLAGACAIQELGGPTIPWRPGREDRDVAACTPDGRLPDAAKDQRHIRDIFSRMGFDDREMVALIGAHALGRCHTDRSGFDGPWNFSPTVFTNEFFRLLAEENWIQKKWNGPKQFTDKSTGTLMMLPTDMALMKDKGFKKHVERYAKDSDVFFKEFSDVFVKLLELGVPFKTEDRFVFKTSE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGGCTGCTAGAACTGCTTCCCGGGCCTTCCTTCGCTCAACCCCGGCGACCTCCTCTTTCCGTCCTGCTGCACGCAGCACCCGTTTCGCCATCCCCGCCAACGGTCTTCGCGCC
TCTCCTCGTCGCGGATATGCTTCGGAAGCTGGCCCGGAGAAGTCTGGCTCATCCTTCGGAATCTGGGCTCTTGGTCTCGGTGCCCTCGGTGGTGGAGCGTACTTCTACCTGAACGGCGAC
TCCGCTTCCTCCCCCAAGAAGCCCTTCGTCCCCACCCAGGCCGACTACCAGAAGGTGTACGACGCTGTCGCTGCCCGTCTGGCCGACGATACCGACTATGATGACGGCAGCTATGGTCCC
GTAAGTAGTCGTTTCTGCTCGTTGTTGTCATTAAAGACCAAAGAACTAACCTAGGCGGTTTTGTTGCTCTCAATAGGTCCTGGTTCGTCTCGCATGGCACGCAAGTGGTACCTATGATAA
GGAGACCGGCACCGGAGGCAGCAACGGCGCCACTATGAGATTCGCCCCGGAGTCCGATCACGGCGCCAACGCCGGTCTCAAGACCGCCCGCGACTTCCTCGAGCCCATCAAGGCTCAGTT
CCCCTGGATCACTTACTCCGATCTGTGGACTCTTGCGGGTGCTTGCGCTATCCAAGAGCTGGGCGGCCCAACGATCCCCTGGAGACCCGGCCGTGAGGACAGGGACGTCGCAGCATGCAC
TCCCGATGGCCGTCTTCCCGACGCCGCCAAGGACCAGCGTCACATCCGCGATATCTTCTCCCGCATGGGCTTTGATGACCGCGAGATGGTTGCACTGATCGGCGCCCATGCCCTGGGTCG
CTGCCACACCGATCGTTCCGGCTTCGACGGCCCCTGGAACTTCAGCCCTACTGTTTTCACGAATGAGTTCTTCCGCCTCCTTGCTGAGGAGAACTGGATCCAGAAGAAGTGGAACGGCCC
GAAACAATTCACCGACAAGTCCACTGGCACTCTCATGATGTTGCCCACTGATATGGCTCTTATGAAGGATAAGGGCTTCAAGAAGCATGTCGAGCGCTATGCCAAGGACAGCGATGTCTT
CTTCAAGGAGTTCTCTGATGTCTTTGTCAAGCTCCTTGAGCTCGGTGTGCCCTTCAAGACTGAGGACCGCTTCGTCTTCAAGACTTCTGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGGCTGCTAGAACTGCTTCCCGGGCCTTCCTTCGCTCAACCCCGGCGACCTCCTCTTTCCGTCCTGCTGCACGCAGCACCCGTTTCGCCATCCCCGCCAACGGTCTTCGCGCC
TCTCCTCGTCGCGGATATGCTTCGGAAGCTGGCCCGGAGAAGTCTGGCTCATCCTTCGGAATCTGGGCTCTTGGTCTCGGTGCCCTCGGTGGTGGAGCGTACTTCTACCTGAACGGCGAC
TCCGCTTCCTCCCCCAAGAAGCCCTTCGTCCCCACCCAGGCCGACTACCAGAAGGTGTACGACGCTGTCGCTGCCCGTCTGGCCGACGATACCGACTATGATGACGGCAGCTATGGTCCC
GTCCTGGTTCGTCTCGCATGGCACGCAAGTGGTACCTATGATAAGGAGACCGGCACCGGAGGCAGCAACGGCGCCACTATGAGATTCGCCCCGGAGTCCGATCACGGCGCCAACGCCGGT
CTCAAGACCGCCCGCGACTTCCTCGAGCCCATCAAGGCTCAGTTCCCCTGGATCACTTACTCCGATCTGTGGACTCTTGCGGGTGCTTGCGCTATCCAAGAGCTGGGCGGCCCAACGATC
CCCTGGAGACCCGGCCGTGAGGACAGGGACGTCGCAGCATGCACTCCCGATGGCCGTCTTCCCGACGCCGCCAAGGACCAGCGTCACATCCGCGATATCTTCTCCCGCATGGGCTTTGAT
GACCGCGAGATGGTTGCACTGATCGGCGCCCATGCCCTGGGTCGCTGCCACACCGATCGTTCCGGCTTCGACGGCCCCTGGAACTTCAGCCCTACTGTTTTCACGAATGAGTTCTTCCGC
CTCCTTGCTGAGGAGAACTGGATCCAGAAGAAGTGGAACGGCCCGAAACAATTCACCGACAAGTCCACTGGCACTCTCATGATGTTGCCCACTGATATGGCTCTTATGAAGGATAAGGGC
TTCAAGAAGCATGTCGAGCGCTATGCCAAGGACAGCGATGTCTTCTTCAAGGAGTTCTCTGATGTCTTTGTCAAGCTCCTTGAGCTCGGTGTGCCCTTCAAGACTGAGGACCGCTTCGTC
TTCAAGACTTCTGAGTAA

Retrieve as FASTA