Entry information : LameCIIBC01
Entry ID 11732
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: LameCIIBC01
Name LameCIIBC01
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria amethystina    [TaxId: 89243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LameCIIBC01
start..stop
S start..stop
LbiCIIBC01 620 0 1..344 1..345
GmarCIIBC06 460 1e-163 1..342 1..341
HsubCIIBC03 444 1e-157 1..343 1..343
HsubCIIBC02 434 1e-153 1..343 1..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 63447..63570 124 N° 2 63622..63686 65 N° 3 63734..63788 55 N° 4 63839..63901 63
N° 5 63966..63978 13 N° 6 64030..64095 66 N° 7 64147..64268 122 N° 8 64324..64418 95
N° 9 64474..64488 15 N° 10 64538..64563 26 N° 11 64620..64634 15 N° 12 64694..64744 51
N° 13 64804..64883 80 N° 14 64938..65068 131 N° 15 65133..65210 78 N° 16 65266..65301 36
join(63447..63570,63622..63686,63734..63788,63839..63901,63966..63978,64030..640 95,64147..64268,64324..64418,64474..64488,64538..64563,64620..64634,64694..64744 ,64804..64883,64938..65068,65133..65210,65266..65301)


exon

Literature and cross-references LameCIIBC01
DNA ref. JGI genome:   scaffold_198 (63447..65301)
Cluster/Prediction ref. JGI gene:   682561
Protein sequence: LameCIIBC01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   345 (323)
PWM (Da):   %s   36007.94 (33709.7)  
PI (pH):   %s   5.47 (5.73) Peptide Signal:   %s   cut: 22 range:22-344
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVALFSTLVTLLFGAQIVDAVGLNSVTCTTGHVTSNKACCPLFPIVDNIQQNLHGGGACGFGAHTALRLAFHDAIGFSIHGGKGGGADGSILIFNTTELAYEANAGIDDITSVQWPIFQTTGLSAGDFVHLAAAVGTANCPGAPRLPFMFGRPHPVAPAPDHTVPQPTDSVDSMLARMADAGFIPAELVALLASHSVANVVDIDPTVAGIPLDSTSGTFDSQLFLEVLLKGTVFPGTGANTGEVKSFTTAEMRLQSDSAIANDHRTACEWQSMINNQARMMLRFKTAMAKLQVLGQDTSKLIDCSDVVPVPKPFSGPIKYPSSFSQANIQQACTEFKFPSVGH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (16 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTCGCTCTTTTCTCCACGCTCGTTACCCTTTTGTTTGGCGCTCAAATCGTTGATGCCGTTGGTCTCAACTCCGTCACCTGTACCACTGGACACGTTACATCGAACAAGGCATGC
TGCC
GTGAGTCATTACGCCCCTTTCTCTTCGAATACTGACCGGAATGGTCACCAGCACTCTTCCCTATTGTTGATAATATTCAACAGAACCTTCATGGCGGTGGAGCGTGTGGGTTTGGA
GTACGAATTTCCCTCATCCACTCTTCTCGTCCTCATCACCCTGCCAGGCGCACACAGCTCTTCGATTGGCCTTCCACGACGCCATTGGATTCTCCATCCATGGTAGGTAATCAGTAACGT
TTGAAACGACCTACTAATCATTCCGTGGTCAGGTGGCAAAGGTGGGGGTGCAGACGGATCAATTCTGATCTTCAATACCACCGAATTGGCCTACGGTGATTTATTTTTGGTCCCAACCTG
TATATTGACGTCCCCTGATGTTCGTAATGATGATTTCAGAGGCCAACGCGGGGTAACTATCCAATCGCCAATTTTTCATTCTATCACTGACCTCAGTCCAAAGGATCGACGATATCACCT
CTGTTCAATGGCCAATTTTCCAAACTACCGGACTGAGTGCCGGAGATTT
GTGAGTGAAACTGTTCCAGTATGAGCATAACCTTACCGATTTTTTCTACAGCGTGCACCTTGCCGCCGCGG
TTGGCACCGCAAATTGTCCAGGCGCACCCAGACTCCCGTTTATGTTTGGCCGTCCTCATCCCGTGGCACCTGCACCTGACCACACCGTACCGCAACCCACTG
GTAACTCCTTGCTATTGA
CCTCTGTGTCTCGTCCTACTAAAGTTGTCGTATCTAGATAGCGTTGATTCCATGCTTGCTCGCATGGCTGATGCTGGATTTATCCCGGCGGAACTTGTGGCTCTGCTCGCATCTCATAGT
GTCGCCAATGTT
GTACGTCTTTCGATTTTTTTGTGTAAGAGCAAATTATTGAATTTTTTTTTGTTAGGTCGACATTGACCCAGTACTTCACCCCGTTTTATCTGCACAATTAATTACTCA
CCCCTTCTTAGACTGTTGCCGGAATACCGTTAGATTCGTGAGTCCTTCCCCAGATGAACTCAGTCTGAGTCCCACTTACGCGTCGAATGATAGAACTTCGGGGACATTGTGAGTATCCGA
CATCCAATCTTCGACCATTAAATGTTCAAGCATGATCTCGTAATTAGTGACTCCCAGTTATTCCTTGAAGTCCTCCTGAAGGGAACGGTATTCCCAGGGTAGGTGTTTATTTTTGGCTGA
CATCCGTACAGTTTATAACTCTATATATCACCCCTAGTACCGGCGCCAACACTGGTGAAGTTAAATCTTTTACCACAGCAGAAATGCGTCTCCAAAGTGACTCAGCCATCGCAAACGGTT
CGTCCTTTGAGTCTTTCTTGCCAAGTATACGGGCTTCAACCTTCGGGATAGATCACAGAACTGCATGCGAATGGCAATCAATGATTAACAACCAGGCGCGGATGATGCTTAGATTCAAAA
CTGCCATGGCCAAACTCCAAGTCCTAGGCCAAGACACAAGTAAACTCATTGATTGCTCCGAT
GTACGTCCTATTTAAAGCATAACATTCAGCAATTAACCTGATCAACAACTCCTATTTC
ACTCAGGTCGTACCTGTGCCCAAACCCTTCTCTGGTCCAATCAAGTACCCAAGCTCATTCTCTCAAGCTAATATCCAACAGGCGGTATGATATATTCACGATATCCGTGACCCATCATAT
TTTTCTAACACAACTGTAGTGCACTGAGTTTAAGTTCCCGTCCGTCGGTCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTCGCTCTTTTCTCCACGCTCGTTACCCTTTTGTTTGGCGCTCAAATCGTTGATGCCGTTGGTCTCAACTCCGTCACCTGTACCACTGGACACGTTACATCGAACAAGGCATGC
TGCC
CACTCTTCCCTATTGTTGATAATATTCAACAGAACCTTCATGGCGGTGGAGCGTGTGGGTTTGGAGCGCACACAGCTCTTCGATTGGCCTTCCACGACGCCATTGGATTCTCCATC
CATG
GTGGCAAAGGTGGGGGTGCAGACGGATCAATTCTGATCTTCAATACCACCGAATTGGCCTACGAGGCCAACGCGGGGATCGACGATATCACCTCTGTTCAATGGCCAATTTTCCAA
ACTACCGGACTGAGTGCCGGAGATTT
CGTGCACCTTGCCGCCGCGGTTGGCACCGCAAATTGTCCAGGCGCACCCAGACTCCCGTTTATGTTTGGCCGTCCTCATCCCGTGGCACCTGCA
CCTGACCACACCGTACCGCAACCCACTG
ATAGCGTTGATTCCATGCTTGCTCGCATGGCTGATGCTGGATTTATCCCGGCGGAACTTGTGGCTCTGCTCGCATCTCATAGTGTCGCCAAT
GTT
GTCGACATTGACCCAACTGTTGCCGGAATACCGTTAGATTCAACTTCGGGGACATTTGACTCCCAGTTATTCCTTGAAGTCCTCCTGAAGGGAACGGTATTCCCAGGTACCGGCGCC
AACACTGGTGAAGTTAAATCTTTTACCACAGCAGAAATGCGTCTCCAAAGTGACTCAGCCATCGCAAACG
ATCACAGAACTGCATGCGAATGGCAATCAATGATTAACAACCAGGCGCGG
ATGATGCTTAGATTCAAAACTGCCATGGCCAAACTCCAAGTCCTAGGCCAAGACACAAGTAAACTCATTGATTGCTCCGAT
GTCGTACCTGTGCCCAAACCCTTCTCTGGTCCAATCAAG
TACCCAAGCTCATTCTCTCAAGCTAATATCCAACAGGCG
TGCACTGAGTTTAAGTTCCCGTCCGTCGGTCACTGA

Retrieve as FASTA