Entry information : TatAPx-CcP02
Entry ID 11741
Creation 2013-04-10 (Christophe Dunand)
Last sequence changes 2013-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TatAPx-CcP02
Name TatAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Trichoderma
Organism Trichoderma atroviride    [TaxId: 63577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TatAPx-CcP02
start..stop
S start..stop
TaspAPx-CcP03 839 0 1..550 1..551
HjAPx-CcP02 716 0 1..547 1..551
TharAPx-CcP03 710 0 1..549 1..556
TviAPx-CcP02 697 0 1..549 1..539
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1598045..1598716 672 N° 2 1598806..1598858 53 N° 3 1598926..1599220 295 N° 4 1599296..1599661 366
N° 5 1599725..1599991 267  
join(1598045..1598716,1598806..1598858,1598926..1599220,1599296..1599661,1599725 ..1599991)


exon

Literature and cross-references TatAPx-CcP02
DNA ref. JGI genome:   contig_25 (1598045..1599991)
Cluster/Prediction ref. JGI gene:   30045
Protein sequence: TatAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   551 (528)
PWM (Da):   %s   58794.79 (56114.5)  
PI (pH):   %s   4.51 (4.42) Peptide Signal:   %s   cut: 23 range:23-550
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWTRTILYSALSSYLWHPANADYVWPNEEIDDLEAILYEQQSIFGAPGSDLASFVSGCSGFGEGTRGGGRNFGAEWLRTAYHDMATADVNAGTGGVDASIMFETDRPENPGKGFSETFGIFSGAYTTRTSMADLLAAAAVISVGTCSNGKVIIPFKAGRVDAAGPGPSGVPQPQEDLASHTASFARQGFDVSEMIALVACGHSIGGVHGVDFPEIVPNPPNTGTDNMVTFDTTNDDFDNKVATEFVANITQNPLAFGQNETTRSDFRIFNADGGKVISQLAASNDYFLSTCTTMLERMINTVPRSVKLTDVLNPIAVKPRNLFITPNADGTLYVNGFIRITNTTVDASKSQVFIHPKSRSGKPLPVATATTKQGMSGGCDYPNCGPGLIFYMFNTTISAEDGISSFTIEIQNDAAGKTSQYDNGGSGFPFSDAIQPLFSLSNQTQLTVDNVNYNQLNVTALVLNAEDFSDISLIIPVPVNFTAPLSPWTQSKVSMKPLSKVPGTNHTLYTASWKAELAARTHPFDIVATGNKGTVSSLYNTWDNVPFVF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGGACTCGGACCATCCTCTACTCTGCTCTCAGCAGTTACCTCTGGCATCCAGCTAACGCTGATTATGTGTGGCCAAATGAAGAAATCGACGACCTTGAGGCTATATTATATGAA
CAACAGAGTATTTTTGGCGCGCCTGGTAGCGACCTTGCCTCGTTTGTCTCAGGCTGCTCTGGATTCGGCGAGGGCACCCGAGGCGGAGGGCGTAATTTCGGCGCTGAATGGCTGAGAACT
GCCTATCACGACATGGCCACGGCAGATGTAAACGCTGGAACCGGCGGTGTGGACGCTTCTATCATGTTCGAGACAGATCGTCCTGAGAATCCGGGAAAGGGATTCTCGGAAACTTTTGGC
ATTTTCAGCGGCGCCTACACTACTCGAACATCGATGGCTGATTTACTCGCAGCGGCGGCGGTGATTTCAGTTGGTACATGCTCGAATGGAAAAGTCATCATCCCGTTCAAGGCCGGACGC
GTTGATGCAGCTGGCCCGGGCCCATCCGGCGTCCCCCAGCCACAAGAAGATCTTGCTTCACATACGGCGAGTTTTGCTAGGCAGGGCTTTGACGTGTCTGAGATGATAGCCCTTGTTGCC
TGCGGACACTCCATTGGAGGTGTGCACGGCGTGGACTTTCCGGAAATTGTCCCCAATCCCCCCAACACAGGC
GTCAGTATATCTCATTTTCCAGACCTGCTGAGAAGCAGCCCATGAAGC
TTGTATAAACTTACTAACTCAATGTCTTGCCTTTTCTCTAGACTGATAATATGGTGACCTTTGATACAACAAACGACGATTTCGACAATAAGGTGTAAGTGCTACTTACTATTCATGTTC
TCCATCCAAGAACCAGCCAACTCATGCCTGTTTTCTTCCAGTGCCACGGAATTTGTCGCCAATATCACTCAAAACCCACTTGCGTTTGGTCAAAACGAAACAACACGATCAGACTTTCGT
ATTTTCAACGCAGACGGGGGCAAAGTAATCTCTCAGCTAGCAGCCTCCAACGATTATTTTCTCAGCACCTGCACCACAATGCTAGAGCGCATGATTAACACCGTGCCTCGCAGCGTAAAG
CTAACAGATGTCCTAAACCCCATCGCCGTCAAGCCAAGAAACTTATTTATTACTCCTAATGCTGATGGAACGTTGTATGTCAATGGTTTTATAAGG
GTACGTATTCAGCCGTTGGATAAT
CACAAACGCCAGAGGCTTCTTTGGCCAGTGAATGCTAACAGCCTGAAATAGATCACCAACACTACAGTTGATGCCAGCAAGAGTCAAGTCTTCATTCACCCCAAATCGCGCTCTGGCAAA
CCTTTACCAGTGGCGACCGCCACTACGAAGCAGGGGATGAGTGGTGGCTGTGACTATCCCAATTGTGGTCCAGGCTTGATTTTCTACATGTTCAACACCACAATTTCAGCTGAAGATGGC
ATATCGTCTTTTACCATTGAGATTCAAAACGACGCCGCCGGAAAAACTTCGCAGTACGATAATGGAGGCTCCGGATTCCCATTTTCCGATGCTATTCAACCTTTGTTTAGCTTATCTAAC
CAGACCCAGCTCACGGTTGATAACGTCAACTATAACCAGCTGAATGTAACCGCGTTG
GTAGGTCTATTGTACATATACTCTGACGCTTTAAAGGCATATGGCTAACATGTTGTCTTTCAG

GTTTTGAATGCTGAAGATTTCTCTGATATCTCGCTCATCATTCCCGTGCCTGTGAACTTTACTGCCCCACTTAGCCCGTGGACTCAAAGCAAAGTGTCGATGAAGCCTTTGAGCAAGGTT
CCAGGAACTAATCATACTTTATACACTGCTTCTTGGAAGGCCGAACTCGCCGCAAGAACCCATCCGTTCGATATTGTTGCTACTGGAAACAAAGGCACTGTTTCGAGCTTATACAATACG
TGGGATAATGTTCCGTTCGTTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGGACTCGGACCATCCTCTACTCTGCTCTCAGCAGTTACCTCTGGCATCCAGCTAACGCTGATTATGTGTGGCCAAATGAAGAAATCGACGACCTTGAGGCTATATTATATGAA
CAACAGAGTATTTTTGGCGCGCCTGGTAGCGACCTTGCCTCGTTTGTCTCAGGCTGCTCTGGATTCGGCGAGGGCACCCGAGGCGGAGGGCGTAATTTCGGCGCTGAATGGCTGAGAACT
GCCTATCACGACATGGCCACGGCAGATGTAAACGCTGGAACCGGCGGTGTGGACGCTTCTATCATGTTCGAGACAGATCGTCCTGAGAATCCGGGAAAGGGATTCTCGGAAACTTTTGGC
ATTTTCAGCGGCGCCTACACTACTCGAACATCGATGGCTGATTTACTCGCAGCGGCGGCGGTGATTTCAGTTGGTACATGCTCGAATGGAAAAGTCATCATCCCGTTCAAGGCCGGACGC
GTTGATGCAGCTGGCCCGGGCCCATCCGGCGTCCCCCAGCCACAAGAAGATCTTGCTTCACATACGGCGAGTTTTGCTAGGCAGGGCTTTGACGTGTCTGAGATGATAGCCCTTGTTGCC
TGCGGACACTCCATTGGAGGTGTGCACGGCGTGGACTTTCCGGAAATTGTCCCCAATCCCCCCAACACAGGC
ACTGATAATATGGTGACCTTTGATACAACAAACGACGATTTCGACAAT
AAGGT
TGCCACGGAATTTGTCGCCAATATCACTCAAAACCCACTTGCGTTTGGTCAAAACGAAACAACACGATCAGACTTTCGTATTTTCAACGCAGACGGGGGCAAAGTAATCTCTCAG
CTAGCAGCCTCCAACGATTATTTTCTCAGCACCTGCACCACAATGCTAGAGCGCATGATTAACACCGTGCCTCGCAGCGTAAAGCTAACAGATGTCCTAAACCCCATCGCCGTCAAGCCA
AGAAACTTATTTATTACTCCTAATGCTGATGGAACGTTGTATGTCAATGGTTTTATAAGG
ATCACCAACACTACAGTTGATGCCAGCAAGAGTCAAGTCTTCATTCACCCCAAATCGCGC
TCTGGCAAACCTTTACCAGTGGCGACCGCCACTACGAAGCAGGGGATGAGTGGTGGCTGTGACTATCCCAATTGTGGTCCAGGCTTGATTTTCTACATGTTCAACACCACAATTTCAGCT
GAAGATGGCATATCGTCTTTTACCATTGAGATTCAAAACGACGCCGCCGGAAAAACTTCGCAGTACGATAATGGAGGCTCCGGATTCCCATTTTCCGATGCTATTCAACCTTTGTTTAGC
TTATCTAACCAGACCCAGCTCACGGTTGATAACGTCAACTATAACCAGCTGAATGTAACCGCGTTG
GTTTTGAATGCTGAAGATTTCTCTGATATCTCGCTCATCATTCCCGTGCCTGTG
AACTTTACTGCCCCACTTAGCCCGTGGACTCAAAGCAAAGTGTCGATGAAGCCTTTGAGCAAGGTTCCAGGAACTAATCATACTTTATACACTGCTTCTTGGAAGGCCGAACTCGCCGCA
AGAACCCATCCGTTCGATATTGTTGCTACTGGAAACAAAGGCACTGTTTCGAGCTTATACAATACGTGGGATAATGTTCCGTTCGTTTTCTAA

Retrieve as FASTA