Entry information : TatAPx-CcP03
Entry ID 11742
Creation 2013-04-10 (Christophe Dunand)
Last sequence changes 2013-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TatAPx-CcP03
Name TatAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Trichoderma
Organism Trichoderma atroviride    [TaxId: 63577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TatAPx-CcP03
start..stop
S start..stop
TviAPx-CcP03 763 0 1..462 1..463
TharAPx-CcP05 754 0 1..461 1..462
TaspAPx-CcP02 639 0 1..339 1..340
HjAPx-CcP03 595 0 1..354 1..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1089783..1090430 648 N° 2 1089608..1089675 68 N° 3 1089263..1089557 295 N° 4 1088760..1089200 441
complement(join(1088760..1089200,1089263..1089557,1089608..1089675,1089783..1090 430))


exon

Literature and cross-references TatAPx-CcP03
DNA ref. JGI genome:   contig_21 (1090430..1088760)
Cluster/Prediction ref. JGI gene:   46525
Protein sequence: TatAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   484 (460)
PWM (Da):   %s   51348.08 (48886.7)  
PI (pH):   %s   4.47 (4.41) Peptide Signal:   %s   cut: 24 range:24-483
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLSYRVLSAITKLGLVAGSAYADSEYIWPNAKTDLLESMLYEQQGFGSGNSPATFIVPCDKVPFGTGRNGAAEWLRTAYHDMATADVVTGVGGLDASIGFEVNRDENPGIGFNETLVNLAAFLTPRSSMADLIALGAVFAANGCSNGSVEIPYRAGRVDATGPGASGVPKPEQPLDEHITNFQRQGFTPQEMIGLVACGHTLGGVHGVDFPEIVPANDQNTQTFDTTNTGFTGFDNTVAVQFVNNVTQNPLAFGHNETTNSDARIFNSDGGEEIGKMADSPSYFYQTCTTLLERMINTVPKGVALTDPIQPIAVKPSQLFATINSDGTMTMSGYIRLAGPVTANPNRTVKIHFHPRSGERDTGASIVSKSITSASSAHVLYGNPPLTFWWYQFSTVIPVTQGVSGFDVEVVDTSNGATNSTMYKNGGQGFPFDDTIVTQPKLSCSETIYNGLMNLTVAVSLPTPNTTSYLSTNANNNTNLDP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCTATCCTACCGCGTCCTCTCTGCCATCACCAAGCTCGGCTTGGTGGCCGGCTCTGCCTATGCTGATAGTGAGTACATTTGGCCTAATGCCAAGACTGACTTGCTCGAGTCTATG
CTCTATGAGCAGCAGGGATTTGGATCTGGCAACTCGCCAGCAACCTTTATCGTCCCCTGCGATAAGGTCCCTTTTGGCACTGGGCGTAATGGAGCTGCAGAATGGCTGCGAACGGCATAT
CATGACATGGCAACTGCGGATGTCGTGACGGGAGTAGGAGGTCTCGACGCGTCTATTGGGTTTGAGGTGAACCGCGATGAGAATCCCGGTATTGGCTTCAACGAAACGCTTGTGAATCTA
GCCGCGTTCCTCACACCGCGTTCATCTATGGCGGATTTGATCGCCTTGGGGGCAGTGTTTGCTGCAAATGGATGCTCAAATGGAAGCGTTGAGATTCCCTATCGAGCGGGTAGAGTTGAT
GCTACAGGACCTGGTGCGTCAGGCGTGCCCAAGCCAGAGCAGCCTTTGGACGAGCACATCACCAATTTCCAGAGACAAGGATTTACGCCGCAAGAGATGATTGGGCTGGTGGCATGTGGC
CATACCCTTGGAGGTGTTCATGGCGTAGACTTTCCTGAGATTGTCCCA
GTCGTTAATGATCCAGTAAGTCGCTATCTGAATAGCCGATGTTAATTGTCACATACTTTGAGGGCTGGCTGT
ACAAGAACTTTGAATGAGCTAACCATTATGCACAGGCAAATGATCAGAACACGCAGACGTTCGACACAACTAACACGGGATTCACCGGGTTTGACAACACTGTGTAAGATGAGTTTACTT
CCTGTCGACGGCCTCGAACTAACTAGAAGTCAGTGCTGTTCAGTTCGTGAACAACGTTACGCAGAATCCACTCGCGTTTGGTCACAATGAGACCACCAACTCCGATGCCAGAATCTTCAA
CTCTGACGGAGGGGAGGAAATTGGGAAAATGGCAGATTCCCCCTCTTACTTCTACCAAACCTGCACAACACTGCTCGAACGAATGATCAATACCGTCCCCAAGGGCGTAGCTCTTACGGA
TCCAATCCAGCCCATTGCCGTAAAGCCTTCCCAGCTATTTGCCACTATCAACTCGGATGGAACGATGACCATGTCTGGCTATATCAGA
GTACGTTTTCTCCTTCCATTGATATGGAAAAC
ACAAGACAAGCGCTAATGGAGATCAAACAGCTTGCTGGCCCCGTAACCGCCAACCCAAACCGCACAGTCAAGATCCACTTCCATCCTCGTTCTGGGGAGAGAGATACTGGCGCTTCTATC
GTTAGCAAAAGCATAACTTCAGCTAGTTCTGCTCATGTCCTCTACGGAAACCCTCCTCTTACTTTCTGGTGGTACCAGTTCTCGACAGTGATTCCCGTCACACAAGGTGTTTCTGGATTT
GACGTGGAGGTTGTCGATACCAGCAACGGAGCCACCAACAGCACCATGTACAAGAATGGTGGCCAAGGATTCCCGTTTGATGATACGATCGTTACGCAGCCAAAGCTGTCATGTTCTGAA
ACAATTTACAACGGACTGATGAACTTGACTGTTGCGGTAAGCCTCCCTACTCCTAATACAACAAGCTATCTGTCCACTAATGCTAATAATAATACCAATTTAGATCCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCTATCCTACCGCGTCCTCTCTGCCATCACCAAGCTCGGCTTGGTGGCCGGCTCTGCCTATGCTGATAGTGAGTACATTTGGCCTAATGCCAAGACTGACTTGCTCGAGTCTATG
CTCTATGAGCAGCAGGGATTTGGATCTGGCAACTCGCCAGCAACCTTTATCGTCCCCTGCGATAAGGTCCCTTTTGGCACTGGGCGTAATGGAGCTGCAGAATGGCTGCGAACGGCATAT
CATGACATGGCAACTGCGGATGTCGTGACGGGAGTAGGAGGTCTCGACGCGTCTATTGGGTTTGAGGTGAACCGCGATGAGAATCCCGGTATTGGCTTCAACGAAACGCTTGTGAATCTA
GCCGCGTTCCTCACACCGCGTTCATCTATGGCGGATTTGATCGCCTTGGGGGCAGTGTTTGCTGCAAATGGATGCTCAAATGGAAGCGTTGAGATTCCCTATCGAGCGGGTAGAGTTGAT
GCTACAGGACCTGGTGCGTCAGGCGTGCCCAAGCCAGAGCAGCCTTTGGACGAGCACATCACCAATTTCCAGAGACAAGGATTTACGCCGCAAGAGATGATTGGGCTGGTGGCATGTGGC
CATACCCTTGGAGGTGTTCATGGCGTAGACTTTCCTGAGATTGTCCCA
GCAAATGATCAGAACACGCAGACGTTCGACACAACTAACACGGGATTCACCGGGTTTGACAACACTGTTGCT
GTTCAGTTCGTGAACAACGTTACGCAGAATCCACTCGCGTTTGGTCACAATGAGACCACCAACTCCGATGCCAGAATCTTCAACTCTGACGGAGGGGAGGAAATTGGGAAAATGGCAGAT
TCCCCCTCTTACTTCTACCAAACCTGCACAACACTGCTCGAACGAATGATCAATACCGTCCCCAAGGGCGTAGCTCTTACGGATCCAATCCAGCCCATTGCCGTAAAGCCTTCCCAGCTA
TTTGCCACTATCAACTCGGATGGAACGATGACCATGTCTGGCTATATCAGA
CTTGCTGGCCCCGTAACCGCCAACCCAAACCGCACAGTCAAGATCCACTTCCATCCTCGTTCTGGGGAG
AGAGATACTGGCGCTTCTATCGTTAGCAAAAGCATAACTTCAGCTAGTTCTGCTCATGTCCTCTACGGAAACCCTCCTCTTACTTTCTGGTGGTACCAGTTCTCGACAGTGATTCCCGTC
ACACAAGGTGTTTCTGGATTTGACGTGGAGGTTGTCGATACCAGCAACGGAGCCACCAACAGCACCATGTACAAGAATGGTGGCCAAGGATTCCCGTTTGATGATACGATCGTTACGCAG
CCAAAGCTGTCATGTTCTGAAACAATTTACAACGGACTGATGAACTTGACTGTTGCGGTAAGCCTCCCTACTCCTAATACAACAAGCTATCTGTCCACTAATGCTAATAATAATACCAAT
TTAGATCCGTGA

Retrieve as FASTA