Entry information : HjAPx-CcP03
Entry ID 11743
Creation 2013-04-10 (Christophe Dunand)
Last sequence changes 2013-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: HjAPx-CcP03
Name HjAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Hypocrea jecorina (Trichoderma reesei)    [TaxId: 51453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HjAPx-CcP03
start..stop
S start..stop
TharAPx-CcP05 618 0 1..338 1..337
TviAPx-CcP03 611 0 1..338 1..337
TaspAPx-CcP02 594 0 1..346 1..347
TatAPx-CcP03 595 0 1..352 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2967414..2968061 648 N° 2 2967240..2967307 68 N° 3 2966677..2967187 511  
complement(join(2966677..2967187,2967240..2967307,2967414..2968061))


exon

Literature and cross-references HjAPx-CcP03
DNA ref. JGI genome:   scaffold_1 (2968061..2966677)
Cluster/Prediction ref. JGI gene:   54129
Protein sequence: HjAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   408 (385)
PWM (Da):   %s   43233.64 (40893.3)  
PI (pH):   %s   5.16 (5.01) Peptide Signal:   %s   cut: 24 range:24-408
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVISVRLLLTVAQLGLIAGSAYAEKEYIWPAKTDLLESMLYEQQGFGSANSPATFIVPCDKVTFGKGRNGAAEWLRTAYHDMATADVEAGTGGIDASIGFEVNRDENVGIGFNETLMNLIAFLTPRSSMADLIALGALFAANGCSNGSVEIPFRAGRVDATGPGPSGVPRPEQPLDEHISSFQKQGFTPQEMIGLVACGHTLGGVHGVDFPEIVDVATDDNTQTFDTTNTGFTAFDNTVAVQYVANNTQNPLAFGHNVTTRSDARIFSSDGGEEIGQMASSPAYFFKRCQTLLERMINTVPRGVTLTDPIQPIPVKPLRLFATINSNGTMTMSGYIRVSLFSHLNKQQRVSFTNIASRSLALSKPTQTAPSSFTSIPVPAHAPNPSPASSATTSLLLLPATSCTATLR

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Incorrect prediction from JGI (3'end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGATCTCAGTCCGCCTCCTGTTAACCGTCGCGCAGCTCGGCCTCATAGCTGGCTCAGCTTATGCCGAGAAGGAATACATCTGGCCCGCCAAGACCGACCTCCTCGAATCTATGCTC
TACGAGCAGCAGGGCTTCGGATCCGCCAACTCTCCTGCAACATTCATCGTTCCCTGCGACAAAGTCACCTTTGGCAAAGGCCGCAATGGCGCTGCGGAATGGCTGCGCACAGCATACCAC
GACATGGCGACTGCCGACGTTGAGGCCGGAACAGGAGGTATCGATGCTTCGATTGGGTTTGAAGTCAACCGAGACGAGAATGTGGGCATCGGCTTCAACGAGACACTGATGAACCTGATT
GCGTTCCTGACGCCGCGTTCCTCCATGGCCGATCTCATCGCTCTGGGGGCCCTCTTCGCTGCAAATGGCTGTTCAAACGGCAGCGTTGAGATTCCTTTCCGGGCCGGCAGAGTCGATGCC
ACGGGCCCGGGTCCGTCAGGCGTGCCGAGGCCAGAGCAGCCGCTGGACGAGCACATCAGCAGCTTCCAGAAGCAGGGCTTCACGCCGCAGGAGATGATTGGATTGGTGGCTTGCGGACAT
ACCCTGGGAGGTGTTCACGGCGTGGACTTTCCCGAGATTGTTGACGTG
GTAAATGATCCGGTATGTTGCTCTTTTGGTGTTTCAGTGTAGCTGGATCATGAAGGGCTACACATGGAGGGT
GTATGTATGCGGCTTGGCTAATGGGTGTGCAAAGGCAACGGACGACAACACTCAGACGTTTGACACGACCAATACGGGCTTCACGGCCTTTGACAACACCGTGTAAGATATCAACGCTTG
TTATCGTAGAGGACTACCAGCTGACTGAAACAAGCGCCGTTCAGTACGTGGCCAACAACACGCAGAATCCTCTTGCTTTCGGCCACAATGTGACCACAAGATCCGACGCGCGAATTTTTA
GCTCGGACGGAGGCGAGGAGATTGGGCAAATGGCATCATCTCCTGCCTACTTCTTCAAAAGGTGCCAGACTCTGCTTGAACGGATGATCAACACGGTTCCGAGGGGCGTCACTTTGACCG
ATCCTATCCAGCCCATTCCCGTGAAGCCGTTGCGTCTGTTTGCTACCATCAACTCCAACGGCACAATGACCATGTCCGGTTACATCAGAGTCAGTCTTTTCAGCCATCTGAACAAACAGC
AACGAGTGTCATTCACTAACATAGCAAGCAGGTCATTGGCTCTGTCGAAGCCAACCCAAACCGCACCGTCAAGCTTCACTTCCATCCCCGTGCCGGCGCATGCACCGAATCCCAGCCCTG
CCTCATCAGCGACAACTTCCCTGCTTTTGCTTCCGGCCACGTCATGTACGGCAACCCTCCGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGATCTCAGTCCGCCTCCTGTTAACCGTCGCGCAGCTCGGCCTCATAGCTGGCTCAGCTTATGCCGAGAAGGAATACATCTGGCCCGCCAAGACCGACCTCCTCGAATCTATGCTC
TACGAGCAGCAGGGCTTCGGATCCGCCAACTCTCCTGCAACATTCATCGTTCCCTGCGACAAAGTCACCTTTGGCAAAGGCCGCAATGGCGCTGCGGAATGGCTGCGCACAGCATACCAC
GACATGGCGACTGCCGACGTTGAGGCCGGAACAGGAGGTATCGATGCTTCGATTGGGTTTGAAGTCAACCGAGACGAGAATGTGGGCATCGGCTTCAACGAGACACTGATGAACCTGATT
GCGTTCCTGACGCCGCGTTCCTCCATGGCCGATCTCATCGCTCTGGGGGCCCTCTTCGCTGCAAATGGCTGTTCAAACGGCAGCGTTGAGATTCCTTTCCGGGCCGGCAGAGTCGATGCC
ACGGGCCCGGGTCCGTCAGGCGTGCCGAGGCCAGAGCAGCCGCTGGACGAGCACATCAGCAGCTTCCAGAAGCAGGGCTTCACGCCGCAGGAGATGATTGGATTGGTGGCTTGCGGACAT
ACCCTGGGAGGTGTTCACGGCGTGGACTTTCCCGAGATTGTTGACGTG
GCAACGGACGACAACACTCAGACGTTTGACACGACCAATACGGGCTTCACGGCCTTTGACAACACCGTCGCC
GTTCAGTACGTGGCCAACAACACGCAGAATCCTCTTGCTTTCGGCCACAATGTGACCACAAGATCCGACGCGCGAATTTTTAGCTCGGACGGAGGCGAGGAGATTGGGCAAATGGCATCA
TCTCCTGCCTACTTCTTCAAAAGGTGCCAGACTCTGCTTGAACGGATGATCAACACGGTTCCGAGGGGCGTCACTTTGACCGATCCTATCCAGCCCATTCCCGTGAAGCCGTTGCGTCTG
TTTGCTACCATCAACTCCAACGGCACAATGACCATGTCCGGTTACATCAGAGTCAGTCTTTTCAGCCATCTGAACAAACAGCAACGAGTGTCATTCACTAACATAGCAAGCAGGTCATTG
GCTCTGTCGAAGCCAACCCAAACCGCACCGTCAAGCTTCACTTCCATCCCCGTGCCGGCGCATGCACCGAATCCCAGCCCTGCCTCATCAGCGACAACTTCCCTGCTTTTGCTTCCGGCC
ACGTCATGTACGGCAACCCTCCGCTGA

Retrieve as FASTA