Entry information : HjAPx-CcP02
Entry ID 11744
Creation 2013-04-10 (Christophe Dunand)
Last sequence changes 2013-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: HjAPx-CcP02
Name HjAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Hypocrea jecorina (Trichoderma reesei)    [TaxId: 51453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HjAPx-CcP02
start..stop
S start..stop
TviAPx-CcP02 846 0 1..550 1..536
TharAPx-CcP03 847 0 1..550 1..553
TatAPx-CcP02 709 0 1..551 1..547
TaspAPx-CcP03 702 0 1..552 1..549
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 57345..58016 672 N° 2 57205..57263 59 N° 3 56828..57119 292 N° 4 56403..56768 366
N° 5 56065..56337 273  
complement(join(56065..56337,56403..56768,56828..57119,57205..57263,57345..58016 ))


exon

Literature and cross-references HjAPx-CcP02
DNA ref. JGI genome:   scaffold_33 (58016..56065)
Cluster/Prediction ref. JGI gene:   112128
Protein sequence: HjAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   553 (531)
PWM (Da):   %s   58742.55 (56351.3)  
PI (pH):   %s   4.27 (4.21) Peptide Signal:   %s   cut: 23 range:23-553
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWSRAITYAALSSLLFRPANAERVWPDPKVDELEKLLYEQENPFDGPGGLASFVDGCSGPAERALGIGRSFGAEWIRNAYHDMSTADVVAGTGGLDASIVFEMDRPENIGDAFQETLNIFKGNYNKRVSMSDLFALATVMAVGGCSDGKVIVPLKGGRVDAAGPGPSGVPEPQQDLPTHSASFAKQGFDTSEMIALVACGHTVGGVHGVDFPEIVPNPTPTDGSKNDNTVTFDSTTDYFDNVVAKEFIANVSQNPLAFGQNETTRSDFRIFNADGGNMISQMATSNDFFLDTCNTMFESMINTVPGNVKLTDINPLDVKPRKLTVTVNDDETLSVTGVIVVDNLINGNGTRIIVHLSSRSGDPLPGVEATTSRGQTGGCSYPNCGPSFTYYTFDSKIPSEHGISSFTVEIVDSQAGTNSIHGNGGAGFPLPDDVLPMFSLSSQGAMTIDGISQMQLNLTAAVLNAERFTNVSLVVPQPSNKSAPISPWTQEEVPMQPLSKVDGTNYTLYTGIWQSSGPTSAASTHPFDIVAMGPHGTVSSLFNSWDDIPRH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGAGCCGTGCTATTACATATGCGGCCTTGAGCAGTCTTTTATTTCGACCCGCAAATGCCGAACGCGTCTGGCCAGACCCAAAAGTCGATGAACTTGAGAAGCTTCTATATGAG
CAAGAGAATCCTTTCGATGGCCCCGGTGGTCTCGCATCCTTTGTTGACGGATGCAGTGGCCCAGCTGAGCGCGCTCTTGGTATAGGCCGCAGCTTTGGTGCAGAATGGATTCGAAATGCC
TATCACGACATGTCAACAGCGGATGTCGTTGCTGGAACTGGTGGGCTGGATGCCTCGATCGTCTTTGAGATGGATCGCCCGGAAAACATTGGTGACGCGTTCCAAGAGACACTCAACATC
TTCAAGGGCAATTACAACAAAAGAGTGTCGATGTCTGATTTATTTGCGTTGGCCACGGTGATGGCAGTTGGTGGGTGTTCTGATGGGAAAGTCATTGTTCCATTGAAGGGAGGCCGGGTG
GACGCAGCTGGCCCGGGTCCGTCTGGTGTCCCAGAACCTCAACAAGATCTTCCGACACATAGTGCAAGTTTTGCGAAACAAGGTTTCGACACTTCTGAGATGATTGCCCTTGTCGCTTGC
GGGCATACGGTCGGAGGTGTTCATGGCGTCGACTTCCCAGAAATTGTCCCAAACCCTACTCCAACGGATGGT
GTTCGTATACCTATTTCTATGGCTGATAACTCCCCCATGCACTCCTGC
CACCCAGTCCACTAACTTGCAGTATGTACATAGTCAAAGAACGATAACACCGTTACCTTTGATTCAACAACAGACTATTTCGACAACGTTGTGTGAGCCTCACTCTGGAATTCTCCATTC
TGCATTCTCTGTCTCCTAACATACAATGTACCTTACTAACGGGAAAACTTATTTCAGTGCCAAAGAATTCATAGCCAACGTCTCTCAGAACCCGCTTGCATTTGGCCAAAACGAAACAAC
GCGGTCGGACTTTCGTATCTTCAACGCAGACGGCGGCAATATGATCTCCCAAATGGCAACGTCAAATGACTTTTTCCTTGATACATGCAACACCATGTTCGAGAGCATGATAAACACGGT
GCCAGGCAATGTCAAATTGACAGACATCAATCCTCTCGATGTCAAGCCAAGAAAATTGACTGTTACTGTTAACGACGATGAAACACTATCAGTAACTGGAGTGATTCGG
GTAAGCTTTCC
TACACTCATAATGCTTCAATGATATACTAAAGAACAGGAACTATACAGGTTGTCGATAACCTCATCAATGGCAACGGAACTCGGATAATTGTACACTTGTCGTCCCGTTCTGGTGACCCA
TTGCCGGGAGTAGAGGCAACCACATCTAGAGGGCAAACGGGAGGCTGTTCATACCCGAATTGCGGTCCAAGTTTCACATATTACACCTTTGACTCGAAAATTCCATCTGAGCACGGCATA
TCATCCTTTACTGTCGAAATCGTAGACAGTCAGGCCGGCACAAACTCCATCCACGGCAATGGTGGCGCCGGCTTTCCTCTACCCGACGATGTCTTGCCAATGTTTTCCCTCTCAAGTCAA
GGTGCAATGACTATCGATGGTATTAGCCAGATGCAGCTTAACCTGACTGCAGCA
GTATGTTGAGCCTGCTCGCCGCGTACCTGACTTGGAATGCGTTCACATTGCTAACCAGATCCCAGG
TTCTCAATGCGGAGAGATTCACAAACGTCTCTCTGGTAGTTCCTCAGCCCTCCAACAAAAGCGCCCCAATCAGCCCATGGACGCAAGAAGAAGTCCCCATGCAGCCTTTGAGTAAGGTTG
ACGGGACCAACTACACGCTTTATACGGGCATATGGCAGAGCAGTGGCCCGACTTCAGCGGCCTCTACACATCCATTCGATATCGTTGCCATGGGGCCACATGGAACAGTCTCAAGCCTAT
TCAACTCTTGGGACGACATTCCCAGGCATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGAGCCGTGCTATTACATATGCGGCCTTGAGCAGTCTTTTATTTCGACCCGCAAATGCCGAACGCGTCTGGCCAGACCCAAAAGTCGATGAACTTGAGAAGCTTCTATATGAG
CAAGAGAATCCTTTCGATGGCCCCGGTGGTCTCGCATCCTTTGTTGACGGATGCAGTGGCCCAGCTGAGCGCGCTCTTGGTATAGGCCGCAGCTTTGGTGCAGAATGGATTCGAAATGCC
TATCACGACATGTCAACAGCGGATGTCGTTGCTGGAACTGGTGGGCTGGATGCCTCGATCGTCTTTGAGATGGATCGCCCGGAAAACATTGGTGACGCGTTCCAAGAGACACTCAACATC
TTCAAGGGCAATTACAACAAAAGAGTGTCGATGTCTGATTTATTTGCGTTGGCCACGGTGATGGCAGTTGGTGGGTGTTCTGATGGGAAAGTCATTGTTCCATTGAAGGGAGGCCGGGTG
GACGCAGCTGGCCCGGGTCCGTCTGGTGTCCCAGAACCTCAACAAGATCTTCCGACACATAGTGCAAGTTTTGCGAAACAAGGTTTCGACACTTCTGAGATGATTGCCCTTGTCGCTTGC
GGGCATACGGTCGGAGGTGTTCATGGCGTCGACTTCCCAGAAATTGTCCCAAACCCTACTCCAACGGATGGT
TCAAAGAACGATAACACCGTTACCTTTGATTCAACAACAGACTATTTC
GACAACGTTGT
TGCCAAAGAATTCATAGCCAACGTCTCTCAGAACCCGCTTGCATTTGGCCAAAACGAAACAACGCGGTCGGACTTTCGTATCTTCAACGCAGACGGCGGCAATATGATC
TCCCAAATGGCAACGTCAAATGACTTTTTCCTTGATACATGCAACACCATGTTCGAGAGCATGATAAACACGGTGCCAGGCAATGTCAAATTGACAGACATCAATCCTCTCGATGTCAAG
CCAAGAAAATTGACTGTTACTGTTAACGACGATGAAACACTATCAGTAACTGGAGTGATTCGG
GTTGTCGATAACCTCATCAATGGCAACGGAACTCGGATAATTGTACACTTGTCGTCC
CGTTCTGGTGACCCATTGCCGGGAGTAGAGGCAACCACATCTAGAGGGCAAACGGGAGGCTGTTCATACCCGAATTGCGGTCCAAGTTTCACATATTACACCTTTGACTCGAAAATTCCA
TCTGAGCACGGCATATCATCCTTTACTGTCGAAATCGTAGACAGTCAGGCCGGCACAAACTCCATCCACGGCAATGGTGGCGCCGGCTTTCCTCTACCCGACGATGTCTTGCCAATGTTT
TCCCTCTCAAGTCAAGGTGCAATGACTATCGATGGTATTAGCCAGATGCAGCTTAACCTGACTGCAGCA
GTTCTCAATGCGGAGAGATTCACAAACGTCTCTCTGGTAGTTCCTCAGCCC
TCCAACAAAAGCGCCCCAATCAGCCCATGGACGCAAGAAGAAGTCCCCATGCAGCCTTTGAGTAAGGTTGACGGGACCAACTACACGCTTTATACGGGCATATGGCAGAGCAGTGGCCCG
ACTTCAGCGGCCTCTACACATCCATTCGATATCGTTGCCATGGGGCCACATGGAACAGTCTCAAGCCTATTCAACTCTTGGGACGACATTCCCAGGCATTAA

Retrieve as FASTA