Entry information : TviCcP01
Entry ID 11745
Creation 2013-04-10 (Christophe Dunand)
Last sequence changes 2013-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TviCcP01
Name TviCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma virens    [TaxId: 29875 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TviCcP01
start..stop
S start..stop
TaspCcP01 642 0 1..352 1..353
TatCcP01 629 0 1..352 1..353
TharCcP01 625 0 1..352 1..353
HjCcP01 621 0 1..352 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1389424..1389892 469 N° 2 1389957..1390549 593  
join(1389424..1389892,1389957..1390549)


exon

Literature and cross-references TviCcP01
DNA ref. JGI genome:   scaffold_2 (1389424..1390549)
Cluster/Prediction ref. JGI gene:   79736 [Incorrect prediction]
Protein sequence: TviCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354
PWM (Da):   %s   39253.48 Transmb domain:   %s   i44-66o
PI (pH):   %s   8.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSARQFARVATRTTTRTFAAAPRQAFRQQGRRFYSSEPEKKSSSLLYLGAAAAAGGLGIWYFTSGASASSKPFVPTQADYQKVYNDIADRLEADYDDGSYGPVLVRLAWHASGTYDKETKTGGSNGATMRFAPESGHGANAGLVAARDFLEPIKAKYPWITYSDLWILGGVCAIQEMHGPIVPYRPGRRDGEAAACTPDGRLPDASQGAKHLRDIFYRMGFNDQEIVALSGGHAIGRCHSNRSGYEGPWTFSPTMLTNDFYKLLLDEKWQYKKWDGPKQLEDKTTKTLMMLPTDHVLTTDKAFRPWVEKYAADNDLFFKDFSAVVLRLFELGVPFAEGSENSRWTFKPTHE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTTCTGCCCGTCAGTTTGCCCGCGTGGCAACCCGCACAACCACCCGCACCTTCGCTGCCGCCCCTCGACAGGCTTTCCGCCAGCAGGGCCGCCGCTTCTACTCTTCTGAGCCC
GAGAAGAAGTCATCTTCTCTCCTGTACCTTGGTGCTGCCGCCGCCGCCGGTGGTCTCGGCATCTGGTACTTCACCTCTGGTGCCTCTGCCTCTTCCAAGCCCTTTGTTCCCACCCAGGCC
GATTACCAGAAGGTCTATAACGACATCGCCGATCGTCTCGAGGCCGACTATGATGATGGCAGCTACGGCCCCGTCCTTGTCCGTCTCGCATGGCACGCCAGCGGTACCTACGACAAGGAG
ACCAAGACTGGTGGCAGCAACGGTGCTACCATGCGATTCGCTCCCGAGAGCGGCCACGGTGCCAACGCCGGTCTGGTTGCCGCTCGTGATTTCCTCGAGCCTATCAAGG
GTGAGTCTCTC
CATTATGCGCGCAATGTTGGGTGTCAACTCGAGTTCTAACAACCAACCCGTAGCCAAGTACCCCTGGATCACTTACTCCGATCTCTGGATCCTCGGCGGTGTCTGCGCCATCCAGGAGAT
GCACGGCCCCATTGTCCCTTACCGACCTGGCCGCCGTGATGGTGAGGCTGCTGCCTGCACCCCCGATGGCCGTCTGCCCGATGCCAGCCAGGGCGCCAAGCACCTGCGTGACATCTTCTA
CCGCATGGGCTTCAACGACCAGGAGATTGTCGCCCTCAGCGGTGGCCACGCCATTGGCCGATGCCACTCCAACCGATCTGGCTATGAGGGCCCTTGGACCTTCTCCCCTACCATGCTGAC
CAACGACTTCTACAAGCTCCTGTTGGACGAGAAGTGGCAGTACAAGAAGTGGGACGGCCCCAAGCAGCTCGAGGACAAGACCACCAAGACCCTCATGATGCTCCCCACCGACCACGTCCT
GACCACCGACAAGGCCTTCCGACCTTGGGTTGAGAAGTATGCTGCCGACAACGACCTGTTCTTCAAGGACTTCTCCGCCGTCGTTCTCCGCCTGTTTGAGCTCGGTGTTCCCTTTGCTGA
GGGCAGCGAGAACAGCCGATGGACCTTCAAGCCCACCCACGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTTCTGCCCGTCAGTTTGCCCGCGTGGCAACCCGCACAACCACCCGCACCTTCGCTGCCGCCCCTCGACAGGCTTTCCGCCAGCAGGGCCGCCGCTTCTACTCTTCTGAGCCC
GAGAAGAAGTCATCTTCTCTCCTGTACCTTGGTGCTGCCGCCGCCGCCGGTGGTCTCGGCATCTGGTACTTCACCTCTGGTGCCTCTGCCTCTTCCAAGCCCTTTGTTCCCACCCAGGCC
GATTACCAGAAGGTCTATAACGACATCGCCGATCGTCTCGAGGCCGACTATGATGATGGCAGCTACGGCCCCGTCCTTGTCCGTCTCGCATGGCACGCCAGCGGTACCTACGACAAGGAG
ACCAAGACTGGTGGCAGCAACGGTGCTACCATGCGATTCGCTCCCGAGAGCGGCCACGGTGCCAACGCCGGTCTGGTTGCCGCTCGTGATTTCCTCGAGCCTATCAAGG
CCAAGTACCCC
TGGATCACTTACTCCGATCTCTGGATCCTCGGCGGTGTCTGCGCCATCCAGGAGATGCACGGCCCCATTGTCCCTTACCGACCTGGCCGCCGTGATGGTGAGGCTGCTGCCTGCACCCCC
GATGGCCGTCTGCCCGATGCCAGCCAGGGCGCCAAGCACCTGCGTGACATCTTCTACCGCATGGGCTTCAACGACCAGGAGATTGTCGCCCTCAGCGGTGGCCACGCCATTGGCCGATGC
CACTCCAACCGATCTGGCTATGAGGGCCCTTGGACCTTCTCCCCTACCATGCTGACCAACGACTTCTACAAGCTCCTGTTGGACGAGAAGTGGCAGTACAAGAAGTGGGACGGCCCCAAG
CAGCTCGAGGACAAGACCACCAAGACCCTCATGATGCTCCCCACCGACCACGTCCTGACCACCGACAAGGCCTTCCGACCTTGGGTTGAGAAGTATGCTGCCGACAACGACCTGTTCTTC
AAGGACTTCTCCGCCGTCGTTCTCCGCCTGTTTGAGCTCGGTGTTCCCTTTGCTGAGGGCAGCGAGAACAGCCGATGGACCTTCAAGCCCACCCACGAGTAA

Retrieve as FASTA