Entry information : TviAPx-CcP03
Entry ID 11746
Creation 2013-04-10 (Christophe Dunand)
Last sequence changes 2013-09-06 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: TviAPx-CcP03
Name TviAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma virens    [TaxId: 29875 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TviAPx-CcP03
start..stop
S start..stop
TharAPx-CcP05 900 0 1..462 1..462
TatAPx-CcP03 763 0 1..463 1..462
HjAPx-CcP03 611 0 1..337 1..338
TaspAPx-CcP02 592 0 1..337 1..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 149056..149700 645 N° 2 148885..148952 68 N° 3 148531..148825 295 N° 4 148062..148466 405
complement(join(148062..148466,148531..148825,148885..148952,149056..149700))


exon

Literature and cross-references TviAPx-CcP03
DNA ref. JGI genome:   scaffold_86 (149700..148062)
Cluster/Prediction ref. JGI gene:   127573 [Incorrect prediction]
Protein sequence: TviAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   470 (447)
PWM (Da):   %s   50036.83 (47707.5)  
PI (pH):   %s   5.06 (4.85) Peptide Signal:   %s   cut: 24 range:24-470
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLSNRLLSAITKLGLVAGSAYAEKGNIWPAKTDLLESMLYEQQGFNSGNSPATFIVPCEKVSFGTGRNGAAEWLRTAYHDMATADVANGIGGIDASIGYEVNRDENPGIGFNETLINLTAFLTPRSSMADLIALGALFAANGCSNGSVEIPFRAGRVDATGPGPTGVPRPEQPLDEHITSFQKQGFSPQEMIGLVACGHTLGGVHGVDFPEIVPATDDNTQTFDTTNSGFTAFDNTVAVQYVNNVTQNPLAFGHNETTRSDARIFGSDGGIEIGRMATSPAYFYKTCQDLLERMINTVPKGVTLTEPLQPYPVKPSRLFATINSNGTMTMTGYIVIGSVAANPNRTIKLHIHPRAGVICSPAKPCTVSNNIPAFASGHVMYGNPPLTFWTYPFSVEVPLAQGISSFDVEVVDNINGVINSTLHTNGGHGFPFDDTILTQPQLSCSEVHSEGLMNLTVAVSFTLSIRRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from JGI (5' end is missing and incorrect splicing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCTGTCAAATCGCCTTCTCTCCGCCATCACCAAGCTCGGCTTGGTAGCAGGCTCTGCTTATGCCGAGAAGGGAAACATCTGGCCCGCGAAAACCGACCTGCTCGAGTCCATGCTC
TATGAGCAACAGGGCTTCAACTCCGGCAACTCTCCTGCAACTTTCATTGTGCCCTGTGAAAAGGTTTCTTTTGGCACTGGCCGCAACGGTGCTGCAGAATGGCTGCGTACAGCATACCAC
GACATGGCGACTGCGGATGTTGCGAATGGAATAGGAGGTATCGACGCGTCGATTGGATATGAAGTCAACCGCGACGAGAACCCGGGTATTGGATTCAACGAGACACTGATCAATCTGACT
GCCTTTTTGACGCCGCGGTCGTCGATGGCGGATCTCATTGCTCTGGGGGCGCTGTTTGCCGCAAATGGTTGCTCAAATGGAAGCGTCGAGATTCCCTTCCGAGCCGGCCGAGTTGATGCT
ACTGGCCCGGGTCCGACAGGCGTGCCCAGGCCGGAGCAGCCCTTGGATGAACACATTACTAGCTTCCAGAAGCAGGGATTCTCTCCGCAAGAAATGATTGGCTTGGTAGCATGTGGTCAT
ACCCTTGGAGGAGTTCACGGCGTGGATTTCCCGGAGATTGTGCCC
GTCGTAAATGATCCGGTAAGATACTCTTTTGGCCATGTCAATATGGTTACGAGACTGGGGCTCGCCTATTCGAAA
TCACAGATAGGCTAACGGTTATACACAGGCCACAGATGACAACACACAGACATTCGACACGACTAACTCCGGATTCACAGCCTTCGACAACACCGTGTAAGCTTAATACTACCACTTGCT
TGCTTGAAAGGGACTACTCACTAACATGAAGCAAGCGCTGTTCAATATGTGAACAACGTCACGCAGAACCCGCTTGCCTTTGGCCACAATGAGACCACTAGATCCGACGCGAGAATCTTT
GGCTCGGATGGGGGCATCGAAATCGGACGCATGGCCACTTCCCCTGCTTACTTCTACAAGACATGCCAAGATCTGCTCGAACGAATGATTAACACGGTCCCCAAGGGTGTGACTCTTACT
GAGCCTCTCCAGCCTTATCCCGTAAAGCCATCGCGTCTATTTGCTACCATTAACTCCAATGGAACTATGACTATGACTGGTTATATCAGA
GTTAGTTCTTTCATCGTTATCGATGCAAGC
ATAAAGAAAGATTCACTAACGGAGGAAATCACAGGTCATCGGCTCTGTCGCGGCCAACCCCAATCGCACCATCAAGCTTCACATTCATCCTCGTGCTGGGGTGATATGCTCACCAGCTAA
GCCTTGCACTGTTAGCAACAACATCCCAGCATTCGCTTCTGGCCATGTCATGTACGGAAACCCCCCACTCACTTTCTGGACGTACCCCTTCTCAGTAGAGGTACCTCTTGCCCAGGGCAT
TTCTAGCTTTGACGTCGAGGTTGTCGATAACATCAACGGGGTGATCAACAGCACTCTGCATACAAATGGAGGCCATGGTTTCCCATTCGATGACACTATTCTCACACAGCCGCAACTCTC
GTGCTCTGAAGTGCACTCCGAGGGATTAATGAACTTGACTGTTGCGGTAAGCTTCACCCTTTCAATTCGGCGTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCTGTCAAATCGCCTTCTCTCCGCCATCACCAAGCTCGGCTTGGTAGCAGGCTCTGCTTATGCCGAGAAGGGAAACATCTGGCCCGCGAAAACCGACCTGCTCGAGTCCATGCTC
TATGAGCAACAGGGCTTCAACTCCGGCAACTCTCCTGCAACTTTCATTGTGCCCTGTGAAAAGGTTTCTTTTGGCACTGGCCGCAACGGTGCTGCAGAATGGCTGCGTACAGCATACCAC
GACATGGCGACTGCGGATGTTGCGAATGGAATAGGAGGTATCGACGCGTCGATTGGATATGAAGTCAACCGCGACGAGAACCCGGGTATTGGATTCAACGAGACACTGATCAATCTGACT
GCCTTTTTGACGCCGCGGTCGTCGATGGCGGATCTCATTGCTCTGGGGGCGCTGTTTGCCGCAAATGGTTGCTCAAATGGAAGCGTCGAGATTCCCTTCCGAGCCGGCCGAGTTGATGCT
ACTGGCCCGGGTCCGACAGGCGTGCCCAGGCCGGAGCAGCCCTTGGATGAACACATTACTAGCTTCCAGAAGCAGGGATTCTCTCCGCAAGAAATGATTGGCTTGGTAGCATGTGGTCAT
ACCCTTGGAGGAGTTCACGGCGTGGATTTCCCGGAGATTGTGCCC
GCCACAGATGACAACACACAGACATTCGACACGACTAACTCCGGATTCACAGCCTTCGACAACACCGTCGCTGTT
CAATATGTGAACAACGTCACGCAGAACCCGCTTGCCTTTGGCCACAATGAGACCACTAGATCCGACGCGAGAATCTTTGGCTCGGATGGGGGCATCGAAATCGGACGCATGGCCACTTCC
CCTGCTTACTTCTACAAGACATGCCAAGATCTGCTCGAACGAATGATTAACACGGTCCCCAAGGGTGTGACTCTTACTGAGCCTCTCCAGCCTTATCCCGTAAAGCCATCGCGTCTATTT
GCTACCATTAACTCCAATGGAACTATGACTATGACTGGTTATATCAGA
GTCATCGGCTCTGTCGCGGCCAACCCCAATCGCACCATCAAGCTTCACATTCATCCTCGTGCTGGGGTGATA
TGCTCACCAGCTAAGCCTTGCACTGTTAGCAACAACATCCCAGCATTCGCTTCTGGCCATGTCATGTACGGAAACCCCCCACTCACTTTCTGGACGTACCCCTTCTCAGTAGAGGTACCT
CTTGCCCAGGGCATTTCTAGCTTTGACGTCGAGGTTGTCGATAACATCAACGGGGTGATCAACAGCACTCTGCATACAAATGGAGGCCATGGTTTCCCATTCGATGACACTATTCTCACA
CAGCCGCAACTCTCGTGCTCTGAAGTGCACTCCGAGGGATTAATGAACTTGACTGTTGCGGTAAGCTTCACCCTTTCAATTCGGCGTTTGTAA

Retrieve as FASTA