Entry information : TviAPx-CcP02
Entry ID 11747
Creation 2013-04-10 (Christophe Dunand)
Last sequence changes 2013-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TviAPx-CcP02
Name TviAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma virens    [TaxId: 29875 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TviAPx-CcP02
start..stop
S start..stop
TharAPx-CcP03 914 0 1..539 1..556
HjAPx-CcP02 846 0 1..536 1..550
TaspAPx-CcP03 700 0 1..539 1..550
TatAPx-CcP02 692 0 1..539 1..549
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3073884..3074022 139 N° 2 3074069..3074556 488 N° 3 3074636..3074694 59 N° 4 3074767..3075061 295
N° 5 3075138..3075503 366 N° 6 3075567..3075839 273  
join(3073884..3074022,3074069..3074556,3074636..3074694,3074767..3075061,3075138 ..3075503,3075567..3075839)


exon

Literature and cross-references TviAPx-CcP02
DNA ref. JGI genome:   scaffold_5 (3073884..3075839)
Cluster/Prediction ref. JGI gene:   147594 [Incorrect splicing]
Protein sequence: TviAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   539 (517)
PWM (Da):   %s   58107.78 (55673.6)  
PI (pH):   %s   4.51 (4.50) Peptide Signal:   %s   cut: 23 range:23-539
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWTRAITYAVLSSCLWLPAEADYIWPNAKIDELDRELYEQVNPFDAERALGIGRSFGAEWIRNAYHDMATADVFSGTGGLDASIVFEMDRPENVGDAFQETLNIFKGSYNTRISMADLFAIATVMAVGACSNGKVIVPFRGGRVDAVGPGPSGVPEPQQDLPTHTLSFAKQGFDTSEMIALVACGHSVGGVHGVDFPEIVPNPVPTTIKNDNTVTFDTTTDNFDNFVAKEFVANISQNPLAFGQNETTRSDFRIFKADGGDMISRMASSNDFFLNTCNIMFERMINTVPRDVKLTDIIEPLAIKPRKLSVAINDNGTLLASGIIVVDNLFSGSKTQVLIHLASRSGEVLPVAIGTTSRGLTGGCGYPNCGPSYTYYRFNSIIPAELGISSFTVETVDTATGKATIHNNGGAGFPMSDAILPMFGLSSQSRTTINGGAQLQLNLTVAVLNAEMFTNVSLIVPQPLNKSAPISPWNQEVVHMEPLYKISGTNFTLYRGIWQSSGPLTATSSHPFDIMAEGSTQTVSSLFNSWDDVEFI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Incorrect prediction from JGI (splicing error).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGGACTCGGGCCATTACGTACGCTGTTTTAAGCTCTTGTCTCTGGCTTCCTGCAGAGGCTGACTATATTTGGCCAAACGCAAAGATCGATGAACTTGACAGAGAGTTATACGAA
CAAGTTAACCCATTTGACG
GTCCGGGGGGGGACTGTTTCCTTTGTTGACGGATGCAGTGGGCCAGCTGAGCGCGCTCTGGGTATAGGGCGCAGCTTTGGTGCTGAGTGGATTAGAAACGC
CTATCACGACATGGCAACAGCGGATGTGTTCTCAGGGACCGGCGGTCTTGATGCCTCAATTGTTTTCGAGATGGATCGTCCTGAAAATGTTGGTGACGCGTTTCAGGAGACTCTAAACAT
TTTCAAGGGCAGCTATAATACTCGAATCTCGATGGCTGATTTATTTGCAATAGCCACAGTAATGGCAGTTGGTGCATGTTCAAATGGAAAAGTCATTGTTCCGTTCAGAGGAGGTCGCGT
GGACGCAGTCGGTCCAGGTCCATCGGGCGTTCCAGAGCCTCAGCAAGATCTGCCAACACATACCTTGAGTTTTGCAAAACAGGGCTTTGATACATCTGAAATGATTGCTCTCGTTGCTTG
CGGCCATAGTGTTGGAGGTGTGCATGGTGTTGACTTTCCAGAAATTGTCCCAAACCCAGTGCCAACCACTGAT
GTTCGTATCTCCATCAGACTGTCTTATGCTGCATTGGCGTTATAATC
GCGACTCAGTTGACTAACTTGCTCCTTCCCAGATAAAAAACGATAATACAGTGACTTTTGATACAACAACGGACAATTTTGACAATTTTGTGTTAGTCTTTCTTTCACACTGCTGTATTA
TCCCATCTGCGCTCCACTGAACTGACCTCTTTCTTCCTGATAGTGCTAAAGAATTTGTCGCCAATATTTCTCAAAACCCGCTTGCGTTTGGTCAAAACGAAACAACACGATCAGACTTCC
GTATTTTCAAGGCAGATGGTGGCGACATGATCTCGCGGATGGCATCGTCTAATGATTTTTTTCTGAATACTTGCAACATTATGTTTGAGCGCATGATTAATACTGTGCCGCGAGATGTTA
AGCTGACAGATATCATCGAACCTCTTGCTATAAAGCCTAGAAAATTGTCCGTTGCAATTAATGACAACGGAACGCTATTAGCAAGTGGAATTATCCGA
GTAAGTGCTATCATTCAGCCCA
GCAACAGAAGCAGATCTGGAGTAATAGCTGACTGCCTGTTTGGATGCGCTACAGGTTGTTGATAACCTATTTAGTGGAAGCAAAACACAGGTTCTTATCCATTTGGCTTCGCGGTCTGGT
GAAGTATTACCCGTTGCCATCGGAACCACATCACGAGGGCTAACTGGAGGCTGCGGCTATCCCAATTGCGGCCCAAGCTACACATATTACAGATTTAATTCTATAATTCCTGCCGAACTG
GGAATATCATCTTTTACCGTTGAAACCGTCGATACCGCAACTGGGAAAGCTACAATCCATAATAATGGTGGGGCTGGATTTCCTATGTCCGATGCTATTCTGCCAATGTTTGGTCTGTCT
AGTCAGAGCAGGACAACCATCAATGGTGGCGCCCAACTGCAGCTCAACTTAACTGTTGCA
GTATGTATAACCCATAATTTACGTGGAGATCAATTTGTATGTGACTAACCATTCTATAAT
CAGGTTTTAAATGCAGAAATGTTTACCAACGTCTCGCTCATTGTTCCACAACCCTTAAACAAAAGTGCGCCAATTAGCCCATGGAATCAAGAAGTAGTTCATATGGAGCCTTTATATAAG
ATCTCCGGAACCAACTTTACGCTCTACAGGGGTATATGGCAGAGTAGTGGTCCATTGACGGCAACCTCTTCGCATCCGTTCGATATTATGGCTGAGGGATCGACGCAAACAGTTTCGAGT
CTCTTTAACTCCTGGGATGATGTTGAATTTATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGGACTCGGGCCATTACGTACGCTGTTTTAAGCTCTTGTCTCTGGCTTCCTGCAGAGGCTGACTATATTTGGCCAAACGCAAAGATCGATGAACTTGACAGAGAGTTATACGAA
CAAGTTAACCCATTTGACG
CTGAGCGCGCTCTGGGTATAGGGCGCAGCTTTGGTGCTGAGTGGATTAGAAACGCCTATCACGACATGGCAACAGCGGATGTGTTCTCAGGGACCGGCGGT
CTTGATGCCTCAATTGTTTTCGAGATGGATCGTCCTGAAAATGTTGGTGACGCGTTTCAGGAGACTCTAAACATTTTCAAGGGCAGCTATAATACTCGAATCTCGATGGCTGATTTATTT
GCAATAGCCACAGTAATGGCAGTTGGTGCATGTTCAAATGGAAAAGTCATTGTTCCGTTCAGAGGAGGTCGCGTGGACGCAGTCGGTCCAGGTCCATCGGGCGTTCCAGAGCCTCAGCAA
GATCTGCCAACACATACCTTGAGTTTTGCAAAACAGGGCTTTGATACATCTGAAATGATTGCTCTCGTTGCTTGCGGCCATAGTGTTGGAGGTGTGCATGGTGTTGACTTTCCAGAAATT
GTCCCAAACCCAGTGCCAACCACTGAT
ATAAAAAACGATAATACAGTGACTTTTGATACAACAACGGACAATTTTGACAATTTTGTTGCTAAAGAATTTGTCGCCAATATTTCTCAAAAC
CCGCTTGCGTTTGGTCAAAACGAAACAACACGATCAGACTTCCGTATTTTCAAGGCAGATGGTGGCGACATGATCTCGCGGATGGCATCGTCTAATGATTTTTTTCTGAATACTTGCAAC
ATTATGTTTGAGCGCATGATTAATACTGTGCCGCGAGATGTTAAGCTGACAGATATCATCGAACCTCTTGCTATAAAGCCTAGAAAATTGTCCGTTGCAATTAATGACAACGGAACGCTA
TTAGCAAGTGGAATTATCCGA
GTTGTTGATAACCTATTTAGTGGAAGCAAAACACAGGTTCTTATCCATTTGGCTTCGCGGTCTGGTGAAGTATTACCCGTTGCCATCGGAACCACATCA
CGAGGGCTAACTGGAGGCTGCGGCTATCCCAATTGCGGCCCAAGCTACACATATTACAGATTTAATTCTATAATTCCTGCCGAACTGGGAATATCATCTTTTACCGTTGAAACCGTCGAT
ACCGCAACTGGGAAAGCTACAATCCATAATAATGGTGGGGCTGGATTTCCTATGTCCGATGCTATTCTGCCAATGTTTGGTCTGTCTAGTCAGAGCAGGACAACCATCAATGGTGGCGCC
CAACTGCAGCTCAACTTAACTGTTGCA
GTTTTAAATGCAGAAATGTTTACCAACGTCTCGCTCATTGTTCCACAACCCTTAAACAAAAGTGCGCCAATTAGCCCATGGAATCAAGAAGTA
GTTCATATGGAGCCTTTATATAAGATCTCCGGAACCAACTTTACGCTCTACAGGGGTATATGGCAGAGTAGTGGTCCATTGACGGCAACCTCTTCGCATCCGTTCGATATTATGGCTGAG
GGATCGACGCAAACAGTTTCGAGTCTCTTTAACTCCTGGGATGATGTTGAATTTATTTAA

Retrieve as FASTA