Entry information : HC14CIIAA01
Entry ID 11753
Creation 2013-04-17 (Christophe Dunand)
Last sequence changes 2013-04-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HC14CIIAA01
Name HC14CIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. C14A    [TaxId: 755336 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HC14CIIAA01
start..stop
S start..stop
HCO27CIIAA01 465 2e-165 1..354 1..352
HEC38CIIAA01 455 2e-161 1..354 1..356
XhypCIIAA02 388 2e-135 1..353 1..351
CgloCIIAA04_ST23 359 2e-121 1..353 1..363
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 85645..86619 975 N° 2 85483..85584 102  
complement(join(85483..85584,85645..86619))


exon

Literature and cross-references HC14CIIAA01
DNA ref. JGI genome:   scaffold_54 (86619..85483)
Cluster/Prediction ref. JGI gene:   209093
Protein sequence: HC14CIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359 (341)
PWM (Da):   %s   38293.77 (36460.8)  
PI (pH):   %s   4.53 (4.47) Peptide Signal:   %s   cut: 18 range:18-358
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPSSLCLSLFATQALAYPGMKATIAEIQARSNSALSRRSTELLGDLKTTDDSDLTTSGSTIKAILDGSSSALADSTTYTPPGELTSDECKNSTICVWYHIAQDLESSFTDDSGCTALARGAIRLGFHDAATWDKNSDYGGADGSIALNDDEAARSENRGLDTIIPQTKTWFDTYKGYGISMADLIQTAAMTASVVCPLGPRIKHYVGRKDDSTAGPTGKLPLPQQDAQFIIDLFAAKTFTSDDLVALLGAHSVSKQRFVDPSRSGASQDSTPAVWDLNYYGETIAGDNETILIFHSDASIASYSTTKDRFKAFSADGAGPAWNAAYAPAYFRMSMLGVNNLNDLTEITQVLPLFRNA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCCTCTTCCCTTTGTCTTTCTCTTTTCGCTACCCAGGCATTGGCTTATCCTGGCATGAAGGCCACTATCGCCGAGATCCAAGCTCGCAGCAACTCCGCTCTCTCGCGAAGATCA
ACCGAGCTTCTAGGTGATCTCAAGACCACCGATGATAGCGACTTAACTACTTCTGGGTCTACCATCAAGGCCATCCTCGACGGGTCAAGTAGTGCGCTCGCGGATAGCACCACATACACA
CCTCCTGGCGAACTGACCTCGGATGAATGCAAAAATTCCACAATATGCGTCTGGTACCACATCGCCCAGGATCTGGAGAGTTCCTTTACGGATGACAGCGGATGCACGGCTCTGGCCCGT
GGTGCTATCCGCCTGGGGTTCCACGACGCTGCGACATGGGACAAGAACTCGGACTACGGCGGTGCCGATGGCTCTATTGCTCTTAACGATGACGAGGCCGCCCGTTCTGAGAACAGAGGC
CTCGACACGATCATTCCGCAGACCAAGACGTGGTTCGACACGTACAAGGGGTACGGCATCAGCATGGCAGACCTAATCCAGACTGCCGCTATGACTGCGTCTGTAGTGTGCCCACTCGGT
CCTCGAATCAAGCACTACGTCGGGCGAAAAGACGACAGCACGGCCGGTCCTACCGGAAAACTGCCGCTGCCCCAGCAGGACGCGCAGTTCATCATTGACCTATTTGCCGCCAAGACATTC
ACATCTGATGATCTAGTCGCGCTGCTTGGCGCACACTCTGTCTCAAAGCAGAGGTTCGTCGACCCGAGTCGAAGCGGCGCTTCCCAAGACTCCACTCCAGCTGTCTGGGACTTGAACTAC
TACGGCGAGACGATCGCCGGCGACAACGAGACCATCCTGATCTTCCACAGCGATGCGAGTATCGCTTCTTACTCCACTACAAAGGATCGATTCAAGGCGTTTTCCGCGGATGGTGCTGGG
CCAGCCTGGAATGCT
GTGAGTATTACTTACCCCTTTCGTCCGACTTCAGACCGCGCTAATAGGCGACCGTTCTAGGCTTATGCTCCAGCGTACTTCCGCATGAGCATGTTGGGTGTTAAT
AACTTGAATGATCTCACTGAGATAACTCAGGTTCTTCCTCTGTTTCGAAATGCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCCTCTTCCCTTTGTCTTTCTCTTTTCGCTACCCAGGCATTGGCTTATCCTGGCATGAAGGCCACTATCGCCGAGATCCAAGCTCGCAGCAACTCCGCTCTCTCGCGAAGATCA
ACCGAGCTTCTAGGTGATCTCAAGACCACCGATGATAGCGACTTAACTACTTCTGGGTCTACCATCAAGGCCATCCTCGACGGGTCAAGTAGTGCGCTCGCGGATAGCACCACATACACA
CCTCCTGGCGAACTGACCTCGGATGAATGCAAAAATTCCACAATATGCGTCTGGTACCACATCGCCCAGGATCTGGAGAGTTCCTTTACGGATGACAGCGGATGCACGGCTCTGGCCCGT
GGTGCTATCCGCCTGGGGTTCCACGACGCTGCGACATGGGACAAGAACTCGGACTACGGCGGTGCCGATGGCTCTATTGCTCTTAACGATGACGAGGCCGCCCGTTCTGAGAACAGAGGC
CTCGACACGATCATTCCGCAGACCAAGACGTGGTTCGACACGTACAAGGGGTACGGCATCAGCATGGCAGACCTAATCCAGACTGCCGCTATGACTGCGTCTGTAGTGTGCCCACTCGGT
CCTCGAATCAAGCACTACGTCGGGCGAAAAGACGACAGCACGGCCGGTCCTACCGGAAAACTGCCGCTGCCCCAGCAGGACGCGCAGTTCATCATTGACCTATTTGCCGCCAAGACATTC
ACATCTGATGATCTAGTCGCGCTGCTTGGCGCACACTCTGTCTCAAAGCAGAGGTTCGTCGACCCGAGTCGAAGCGGCGCTTCCCAAGACTCCACTCCAGCTGTCTGGGACTTGAACTAC
TACGGCGAGACGATCGCCGGCGACAACGAGACCATCCTGATCTTCCACAGCGATGCGAGTATCGCTTCTTACTCCACTACAAAGGATCGATTCAAGGCGTTTTCCGCGGATGGTGCTGGG
CCAGCCTGGAATGCT
GCTTATGCTCCAGCGTACTTCCGCATGAGCATGTTGGGTGTTAATAACTTGAATGATCTCACTGAGATAACTCAGGTTCTTCCTCTGTTTCGAAATGCATAG

Retrieve as FASTA