Entry information : HC14APx-CcP01
Entry ID 11756
Creation 2013-04-17 (Christophe Dunand)
Last sequence changes 2013-04-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HC14APx-CcP01
Name HC14APx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. C14A    [TaxId: 755336 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HC14APx-CcP01
start..stop
S start..stop
HEC38APx-CcP01 852 0 22..542 1..510
DescAPx-CcP01 843 0 1..542 1..530
HCO27APx-CcP01 820 0 22..542 1..482
AmonAPx-CcP03 557 0 21..542 26..542
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8666..9059 394 N° 2 9142..9365 224 N° 3 9456..9918 463 N° 4 9946..10493 548
join(8666..9059,9142..9365,9456..9918,9946..10493)


exon

Literature and cross-references HC14APx-CcP01
DNA ref. JGI genome:   scaffold_98 (8666..10493)
Cluster/Prediction ref. JGI gene:   67718
Protein sequence: HC14APx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   543
PWM (Da):   %s   57300.3  
PI (pH):   %s   4.17
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSSSSTAVALLGAVSKPVAAMFYYPNPAASVLEHILVDNWGAYASNFTSAITPCTNYVTEAGEPAINSRRTTSAQWLRVAFHDFATADVAAGTGGVDASIGFETERAENSGTAFNDSFTFWQPFVNEFVPMADLLAIGTVMSVNVCGGKYIPYKYGRVDATEADPKTGVPEPSTGIEETLAQFAQTGFNQSDAIKLTACGHTLGVHAGGFPEVVEESAITPTNTNGAVDLDNSRAVFDSAVVHEYIDNTGARGGPLVTSFNETSRSDLRLYESDGNKTMLELYGQGDDGFQDTCVDLLSRMLNTVPTGVELQPAISPALIKPINVTWDVTSDNQLTLSGKIRVSDKAQRMNSMSTWLRMSSDPVPVTFSNNHTETLAPEENLGISAFKLDGSETNATTQYLPLSVSSSDISGATSFTVAPAGLEAQTFEIQDNAFVVPSLTRIADGTLSVTVAARTNRAEFDPAKVSVKIATPLAQPLTLTPTIVRTNVPLKEGESPLADFGYWSGSAAVENPTGAVSVTLLSGEDVVDTLLLDAGVAGW

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTAGCTCTTCCAGTACCGCCGTAGCGCTTCTAGGCGCGGTCTCCAAGCCAGTTGCCGCCATGTTCTACTACCCGAATCCCGCAGCTTCTGTTCTGGAGCATATCTTGGTGGACAAC
TGGGGCGCCTATGCCTCTAACTTTACGTCGGCTATCACACCTTGCACCAACTATGTCACGGAGGCAGGCGAACCAGCAATCAACTCTCGCCGAACTACATCGGCGCAATGGCTACGTGTT
GCCTTCCACGACTTCGCCACGGCCGACGTAGCAGCCGGGACAGGTGGCGTGGATGCAAGTATCGGTTTCGAGACGGAACGTGCCGAGAACTCGGGCACCGCGTTCAACGACAGCTTCACA
TTCTGGCAACCCTTCGTCAACGAGTTCGTCCCTA
GTAAGCTAACTTCACCATCCTCAGTGCGAATATCTAATATTATGATTTGAGCATGGTATGCTGACTATACTCTCCGCTGAAGTGGC
CGATCTGCTTGCTATTGGGACGGTGATGTCGGTTAACGTCTGTGGAGGAAAGTATATACCGTACAAGTACGGCAGGGTTGATGCAACGGAGGCCGACCCTAAGACAGGTGTACCAGAACC
GAGTACGGGCATTGAGGAGACACTAGCCCAGTTTGCGCAAACCGGCTTCAATCAATCAGACGCTATCAAGTTGACCGCATGTGGTCATACACTTGGATCC
GTAAGTGGACTGCCCCAATG
AGGGAATGCTGAGTGTTCCGAAAGAGCACCGGTACGCCCCTTTCGGAATTGACATTAACCGTGTCTGTAGGTGCACGCTGGTGGTTTCCCGGAGGTAGTGGAGGAGTCAGCCATAACCCC
GACCAACACCAACGGTGCTGTAGACCTTGACAACAGCCGAGCAGTGTTTGACTCGGCAGTGGTGCACGAGTATATTGACAACACGGGAGCTAGGGGTGGTCCGCTTGTAACAAGCTTCAA
CGAGACTAGCAGATCCGATCTTCGGCTTTACGAGAGCGATGGCAACAAGACCATGTTGGAGTTGTACGGTCAGGGAGACGACGGATTCCAGGATACCTGCGTCGACTTGCTGAGCCGTAT
GCTGAACACTGTTCCTACTGGCGTTGAGCTCCAGCCCGCGATTTCACCAGCGCTCATCAAGCCAATCAACGTGACTTGGGATGTCACCAGCGACAACCAGCTCACCCTCTCCGGGAAGAT
CAGGGTAAGTGACAAAGCACAACGCATGAACTCCATGTCGACATGGCTAAGAA
GTGATTAGGTGCTGTATTCGGGAGAAGTGTCAAGCGATCCAGTCCCCGTTACTTTCTCGAACAACCA
CACGGAAACCTTGGCTCCTGAAGAGAACTTGGGCATCTCTGCGTTCAAGCTCGACGGCAGCGAAACGAACGCTACAACGCAGTACTTGCCCCTTTCGGTATCCAGCAGTGATATTTCGGG
AGCGACATCTTTCACTGTAGCGCCGGCAGGATTGGAGGCCCAGACTTTCGAGATCCAAGACAATGCTTTTGTTGTTCCTAGCCTGACCCGTATTGCGGACGGTACTCTGTCTGTTACGGT
CGCGGCGAGGACTAATCGTGCCGAGTTCGATCCGGCGAAAGTGTCGGTCAAAATCGCGACTCCTTTGGCGCAGCCGCTTACGCTCACGCCGACAATCGTACGAACAAATGTTCCCCTTAA
GGAAGGAGAGAGCCCGCTGGCTGACTTCGGCTACTGGTCTGGATCCGCCGCAGTGGAGAATCCCACTGGAGCCGTTAGTGTGACCTTGTTGTCCGGTGAGGATGTTGTCGACACTTTGCT
GCTCGATGCCGGAGTTGCGGGTTGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTAGCTCTTCCAGTACCGCCGTAGCGCTTCTAGGCGCGGTCTCCAAGCCAGTTGCCGCCATGTTCTACTACCCGAATCCCGCAGCTTCTGTTCTGGAGCATATCTTGGTGGACAAC
TGGGGCGCCTATGCCTCTAACTTTACGTCGGCTATCACACCTTGCACCAACTATGTCACGGAGGCAGGCGAACCAGCAATCAACTCTCGCCGAACTACATCGGCGCAATGGCTACGTGTT
GCCTTCCACGACTTCGCCACGGCCGACGTAGCAGCCGGGACAGGTGGCGTGGATGCAAGTATCGGTTTCGAGACGGAACGTGCCGAGAACTCGGGCACCGCGTTCAACGACAGCTTCACA
TTCTGGCAACCCTTCGTCAACGAGTTCGTCCCTA
TGGCCGATCTGCTTGCTATTGGGACGGTGATGTCGGTTAACGTCTGTGGAGGAAAGTATATACCGTACAAGTACGGCAGGGTTGAT
GCAACGGAGGCCGACCCTAAGACAGGTGTACCAGAACCGAGTACGGGCATTGAGGAGACACTAGCCCAGTTTGCGCAAACCGGCTTCAATCAATCAGACGCTATCAAGTTGACCGCATGT
GGTCATACACTTGGATCC
GTGCACGCTGGTGGTTTCCCGGAGGTAGTGGAGGAGTCAGCCATAACCCCGACCAACACCAACGGTGCTGTAGACCTTGACAACAGCCGAGCAGTGTTTGAC
TCGGCAGTGGTGCACGAGTATATTGACAACACGGGAGCTAGGGGTGGTCCGCTTGTAACAAGCTTCAACGAGACTAGCAGATCCGATCTTCGGCTTTACGAGAGCGATGGCAACAAGACC
ATGTTGGAGTTGTACGGTCAGGGAGACGACGGATTCCAGGATACCTGCGTCGACTTGCTGAGCCGTATGCTGAACACTGTTCCTACTGGCGTTGAGCTCCAGCCCGCGATTTCACCAGCG
CTCATCAAGCCAATCAACGTGACTTGGGATGTCACCAGCGACAACCAGCTCACCCTCTCCGGGAAGATCAGGGTAAGTGACAAAGCACAACGCATGAACTCCATGTCGACATGGCTAAGA
A
TGTCAAGCGATCCAGTCCCCGTTACTTTCTCGAACAACCACACGGAAACCTTGGCTCCTGAAGAGAACTTGGGCATCTCTGCGTTCAAGCTCGACGGCAGCGAAACGAACGCTACAACG
CAGTACTTGCCCCTTTCGGTATCCAGCAGTGATATTTCGGGAGCGACATCTTTCACTGTAGCGCCGGCAGGATTGGAGGCCCAGACTTTCGAGATCCAAGACAATGCTTTTGTTGTTCCT
AGCCTGACCCGTATTGCGGACGGTACTCTGTCTGTTACGGTCGCGGCGAGGACTAATCGTGCCGAGTTCGATCCGGCGAAAGTGTCGGTCAAAATCGCGACTCCTTTGGCGCAGCCGCTT
ACGCTCACGCCGACAATCGTACGAACAAATGTTCCCCTTAAGGAAGGAGAGAGCCCGCTGGCTGACTTCGGCTACTGGTCTGGATCCGCCGCAGTGGAGAATCCCACTGGAGCCGTTAGT
GTGACCTTGTTGTCCGGTGAGGATGTTGTCGACACTTTGCTGCTCGATGCCGGAGTTGCGGGTTGGTAA

Retrieve as FASTA