Entry information : HC14APx-CcP02
Entry ID 11757
Creation 2013-04-17 (Christophe Dunand)
Last sequence changes 2013-04-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HC14APx-CcP02
Name HC14APx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. C14A    [TaxId: 755336 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HC14APx-CcP02
start..stop
S start..stop
CfioAPx-CcP01_PJ7 573 0 1..541 1..536
CfioAPx-CcP01_MH18 569 0 1..541 1..536
CorbiAPx-CcP1 567 0 12..543 9..539
CgloAPx-CcP03_ST23 562 0 1..543 1..539
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51032..51176 145 N° 2 51240..51655 416 N° 3 51718..51737 20 N° 4 51872..52928 1057
join(51032..51176,51240..51655,51718..51737,51872..52928)


exon

Literature and cross-references HC14APx-CcP02
DNA ref. JGI genome:   scaffold_139 (51032..52928)
Cluster/Prediction ref. JGI gene:   325969
Protein sequence: HC14APx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   546 (526)
PWM (Da):   %s   58364.56 (56327.4)  
PI (pH):   %s   4.27 (4.22) Peptide Signal:   %s   cut: 20 range:20-545
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTQALVGLGLFHASSVLAADYIWPSKLDYLEDLLGLIDGYVKEGFADGVLTCAFGNNQPGRQNAAEWIRTAYHDMSTHDIATGTGGLDASIMFELDRDENVGDAFNNTFGFLSGFHNIRASAADLIALAAVAATDRCNGPKVAFRAGRIDATEAGISGVPKPDETIETHTSRFATAGFNTSDMIAVACGHTVGGVHNDDFPEITGDTNASTTHFFEEETTDSSNLFDNVVVTGYLDGSTENPLAVGSNDTTNSDKRVFNADGNKTMNALADPEVFQSTCADILGRMIDTVPSTVTLSDPIQPVDVKPYIQKFALNSNGTLDFQGRVRVRTSKDTGRNNDDLEVHLTYADRTGANTSTVIATTKLTYKLGTSSGFFGEQFKWFEFETTLDTAESISKFHIHLETPSTGAVELFDNGGNGFPIDDSVLFQGPQSCLVTTSGPDYQGTLTISAAVRKDRATEPLVLDLVHKVPRQGVVIDALDVRPETFTAAGAEKGAYVLFNIDVPLEVSSWSTTFDLVLGSGETESRADFLSTGSLISQSCTPL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACACAAGCCCTTGTCGGGCTTGGACTCTTCCATGCCTCTAGCGTTCTCGCTGCTGATTATATCTGGCCTTCAAAGTTGGACTACCTTGAAGACCTTCTGGGGTTGATCGATGGA
TATGTCAAAGAAGGGTTCGCTGATG
GTAATTATCCAAATCTCACACCAGCTCTTCTTTATAAGCACACCTACTAACTAAAATTCGTAGGAGTTCTTACTTGTGCCTTTGGTAATAACCAA
CCAGGCCGACAGAATGCGGCGGAATGGATTCGAACAGCATACCACGACATGTCAACACACGACATAGCAACCGGTACTGGTGGGTTAGATGCATCTATCATGTTTGAGCTGGATCGAGAT
GAAAACGTCGGCGATGCTTTTAATAATACCTTCGGGTTTCTGAGTGGCTTCCATAACATTAGGGCGTCTGCAGCAGACCTGATCGCACTAGCTGCGGTCGCGGCAACGGATAGATGTAAT
GGACCGAAGGTAGCTTTCCGTGCTGGTCGTATCGATGCCACCGAGGCTGGAATATCAGGAGTCCCTAAGCCCGATGAGACTATCGAAACTCATACTTCAAGATTCGCCACGGCTGGATTT
AATACTTCTGATATGATCGCAATG
GTGAGTGGTGACGAGCAAGGAGTTAGACATATTGAAAAACTACTAACATAGTCTTTGAATAGGTTGCCTGTGGCCATACAGTGTAAGTCCTACTAC
TCTTTTGAGATGCTATGAGTAGAGAAACTTAGGACCCACGACCGCCATAACAAGGCCTACTCCCTTCCTACTCCCTACCAATTCATCTTCCCACGTTCTGAGACTAACTTACGGCCATAG

TGGAGGTGTACACAATGATGATTTCCCAGAGATCACCGGCGACACCAATGCATCGACAACACATTTCTTCGAAGAAGAAACTACCGACTCCTCCAACTTATTCGACAATGTCGTAGTAAC
CGGTTACCTGGATGGTTCCACGGAAAACCCCCTGGCAGTGGGCAGCAATGACACAACAAACTCCGACAAGCGAGTTTTCAACGCCGACGGAAACAAGACGATGAATGCCCTGGCCGATCC
AGAAGTCTTCCAGTCTACATGCGCCGACATCCTCGGGCGCATGATCGACACGGTGCCATCCACCGTGACCCTAAGCGACCCCATCCAGCCCGTCGACGTCAAGCCGTACATTCAAAAGTT
CGCACTGAACAGCAACGGGACACTAGACTTCCAAGGCCGCGTCCGTGTGCGTACTAGCAAGGACACGGGCAGAAACAATGACGACTTGGAGGTGCACCTGACGTATGCCGACCGCACGGG
GGCCAACACTTCCACGGTCATCGCCACGACCAAGCTCACCTACAAACTCGGCACCTCGAGCGGCTTCTTCGGAGAGCAGTTCAAGTGGTTCGAGTTCGAGACGACGCTGGATACCGCCGA
GAGCATCAGCAAGTTCCACATCCACCTCGAGACGCCGTCGACCGGCGCGGTGGAGCTCTTCGACAACGGCGGAAACGGATTCCCCATCGACGACTCGGTGCTGTTCCAGGGCCCGCAGTC
CTGTCTTGTTACCACTTCCGGTCCCGACTACCAGGGGACTCTGACCATCTCGGCGGCTGTCCGGAAAGATAGGGCGACGGAGCCCCTTGTTCTGGACCTGGTGCACAAGGTGCCGCGCCA
GGGCGTGGTGATCGATGCGCTGGACGTTAGACCGGAGACATTCACCGCTGCCGGGGCGGAGAAGGGTGCTTATGTCCTCTTCAACATTGACGTGCCGCTGGAGGTCTCCAGCTGGAGCAC
GACGTTTGATCTGGTGCTGGGAAGTGGAGAGACGGAGAGCCGGGCTGATTTCCTTTCTACTGGTAGTTTGATTTCTCAGAGTTGTACGCCGTTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACACAAGCCCTTGTCGGGCTTGGACTCTTCCATGCCTCTAGCGTTCTCGCTGCTGATTATATCTGGCCTTCAAAGTTGGACTACCTTGAAGACCTTCTGGGGTTGATCGATGGA
TATGTCAAAGAAGGGTTCGCTGATG
GAGTTCTTACTTGTGCCTTTGGTAATAACCAACCAGGCCGACAGAATGCGGCGGAATGGATTCGAACAGCATACCACGACATGTCAACACACGAC
ATAGCAACCGGTACTGGTGGGTTAGATGCATCTATCATGTTTGAGCTGGATCGAGATGAAAACGTCGGCGATGCTTTTAATAATACCTTCGGGTTTCTGAGTGGCTTCCATAACATTAGG
GCGTCTGCAGCAGACCTGATCGCACTAGCTGCGGTCGCGGCAACGGATAGATGTAATGGACCGAAGGTAGCTTTCCGTGCTGGTCGTATCGATGCCACCGAGGCTGGAATATCAGGAGTC
CCTAAGCCCGATGAGACTATCGAAACTCATACTTCAAGATTCGCCACGGCTGGATTTAATACTTCTGATATGATCGCAATG
GTTGCCTGTGGCCATACAGTTGGAGGTGTACACAATGAT
GATTTCCCAGAGATCACCGGCGACACCAATGCATCGACAACACATTTCTTCGAAGAAGAAACTACCGACTCCTCCAACTTATTCGACAATGTCGTAGTAACCGGTTACCTGGATGGTTCC
ACGGAAAACCCCCTGGCAGTGGGCAGCAATGACACAACAAACTCCGACAAGCGAGTTTTCAACGCCGACGGAAACAAGACGATGAATGCCCTGGCCGATCCAGAAGTCTTCCAGTCTACA
TGCGCCGACATCCTCGGGCGCATGATCGACACGGTGCCATCCACCGTGACCCTAAGCGACCCCATCCAGCCCGTCGACGTCAAGCCGTACATTCAAAAGTTCGCACTGAACAGCAACGGG
ACACTAGACTTCCAAGGCCGCGTCCGTGTGCGTACTAGCAAGGACACGGGCAGAAACAATGACGACTTGGAGGTGCACCTGACGTATGCCGACCGCACGGGGGCCAACACTTCCACGGTC
ATCGCCACGACCAAGCTCACCTACAAACTCGGCACCTCGAGCGGCTTCTTCGGAGAGCAGTTCAAGTGGTTCGAGTTCGAGACGACGCTGGATACCGCCGAGAGCATCAGCAAGTTCCAC
ATCCACCTCGAGACGCCGTCGACCGGCGCGGTGGAGCTCTTCGACAACGGCGGAAACGGATTCCCCATCGACGACTCGGTGCTGTTCCAGGGCCCGCAGTCCTGTCTTGTTACCACTTCC
GGTCCCGACTACCAGGGGACTCTGACCATCTCGGCGGCTGTCCGGAAAGATAGGGCGACGGAGCCCCTTGTTCTGGACCTGGTGCACAAGGTGCCGCGCCAGGGCGTGGTGATCGATGCG
CTGGACGTTAGACCGGAGACATTCACCGCTGCCGGGGCGGAGAAGGGTGCTTATGTCCTCTTCAACATTGACGTGCCGCTGGAGGTCTCCAGCTGGAGCACGACGTTTGATCTGGTGCTG
GGAAGTGGAGAGACGGAGAGCCGGGCTGATTTCCTTTCTACTGGTAGTTTGATTTCTCAGAGTTGTACGCCGTTATGA

Retrieve as FASTA