Entry information : HC14CIIAB01
Entry ID 11758
Creation 2013-04-17 (Christophe Dunand)
Last sequence changes 2013-04-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HC14CIIAB01
Name HC14CIIAB01
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. C14A    [TaxId: 755336 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HC14CIIAB01
start..stop
S start..stop
HEC38CIIAB01 413 7e-148 1..267 1..267
HCO27CIIAB01 406 3e-145 1..267 1..267
DescCIIAB01 396 4e-141 1..267 1..271
RrufCIIAB01 298 7e-102 24..263 34..273
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 81361..81694 334 N° 2 80912..81299 388 N° 3 80773..80854 82  
complement(join(80773..80854,80912..81299,81361..81694))


exon

Literature and cross-references HC14CIIAB01
DNA ref. JGI genome:   scaffold_15 (81694..80773)
Cluster/Prediction ref. JGI gene:   259137
Protein sequence: HC14CIIAB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   268 (245)
PWM (Da):   %s   27295.94 (24909.6)  
PI (pH):   %s   3.69 (3.63) Peptide Signal:   %s   cut: 23 range:23-267
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSFRPTVLLATLVAQYGLVAAQCPAVWTDVATDLKSSFLDTSGACTDDARAAIRLAFHDCFPGSCDGSIILANECSDRGENTQLVDICTTLGDKATSFNVSTADLIQFAAAAGIAACPGMPAITVMVGRTDSSTANAEDQIPSPTDDAATIVSAFAAKGFTATELVALIGAHSAAKDLNGNGLDSTVDEMDNTFYTETADGTAPASLTSDQNLANGTDTSSDWTTFGSDASAWADAFVPAMEKLGLLGTDGATLTDCTSIVTEAFA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTTTCAGACCTACGGTTCTCCTTGCGACTTTGGTCGCCCAATACGGACTTGTTGCTGCTCAGTGCCCAGCAGTCTGGACTGACGTTGCCACGGACTTGAAGTCTAGCTTCTTG
GATACCAGTGGAGCTTGCACTGATGATGCTCGGGCTGCCATCCGACTGGCCTTCCACGACTGCTTCCCGGGCTCTTGTGACGGATCCATCATCCTGGCGAATGAGTGCAGCGACCGTGGC
GAGAACACCCAACTCGTTGATATTTGCACGACCCTGGGCGACAAAGCCACGAGCTTCAACGTCAGCACTGCTGATTTGATTCAGTTCGCTGCTG
GTAAGTTTCCCCTGAATTGTTCCATA
TTAGTATATTCAGTCTAACCAATATGTTCTTACAGCTGCTGGAATCGCAGCATGCCCTGGCATGCCCGCTATAACCGTCATGGTTGGCCGAACGGACTCGTCCACCGCAAACGCGGAAGA
CCAAATTCCTAGTCCCACCGATGATGCCGCCACAATAGTCTCCGCCTTCGCTGCCAAGGGCTTCACAGCCACGGAGCTGGTCGCTCTTATTGGAGCCCACAGCGCTGCTAAGGACCTGAA
CGGCAACGGCCTCGACTCGACGGTCGATGAGATGGACAACACCTTCTACACCGAGACCGCTGACGGCACTGCCCCTGCCAGTCTTACCAGCGACCAGAACCTCGCCAACGGAACAGACAC
GAGCTCCGACTGGACCACTTTCGGCAGCGATGCCTCCGCGTGGGCTGATGCCTTTGTGCCTGC
GTAAGTTACATACTTTTCGGTTCCGTTCCTTTAAGCATATTCTAACATAATTCATAG

GATGGAGAAGTTGGGCCTGCTCGGCACTGACGGTGCCACCTTGACAGACTGCACCAGCATCGTCACGGAAGCTTTTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTTTCAGACCTACGGTTCTCCTTGCGACTTTGGTCGCCCAATACGGACTTGTTGCTGCTCAGTGCCCAGCAGTCTGGACTGACGTTGCCACGGACTTGAAGTCTAGCTTCTTG
GATACCAGTGGAGCTTGCACTGATGATGCTCGGGCTGCCATCCGACTGGCCTTCCACGACTGCTTCCCGGGCTCTTGTGACGGATCCATCATCCTGGCGAATGAGTGCAGCGACCGTGGC
GAGAACACCCAACTCGTTGATATTTGCACGACCCTGGGCGACAAAGCCACGAGCTTCAACGTCAGCACTGCTGATTTGATTCAGTTCGCTGCTG
CTGCTGGAATCGCAGCATGCCCTGGC
ATGCCCGCTATAACCGTCATGGTTGGCCGAACGGACTCGTCCACCGCAAACGCGGAAGACCAAATTCCTAGTCCCACCGATGATGCCGCCACAATAGTCTCCGCCTTCGCTGCCAAGGGC
TTCACAGCCACGGAGCTGGTCGCTCTTATTGGAGCCCACAGCGCTGCTAAGGACCTGAACGGCAACGGCCTCGACTCGACGGTCGATGAGATGGACAACACCTTCTACACCGAGACCGCT
GACGGCACTGCCCCTGCCAGTCTTACCAGCGACCAGAACCTCGCCAACGGAACAGACACGAGCTCCGACTGGACCACTTTCGGCAGCGATGCCTCCGCGTGGGCTGATGCCTTTGTGCCT
GC
GATGGAGAAGTTGGGCCTGCTCGGCACTGACGGTGCCACCTTGACAGACTGCACCAGCATCGTCACGGAAGCTTTTGCTTAA

Retrieve as FASTA